• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Chapter 17  genetoprotein
 

Chapter 17 genetoprotein

on

  • 505 views

 

Statistics

Views

Total Views
505
Views on SlideShare
504
Embed Views
1

Actions

Likes
0
Downloads
25
Comments
0

1 Embed 1

http://rlbio102.wikispaces.com 1

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Chapter 17  genetoprotein Chapter 17 genetoprotein Presentation Transcript

    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsPowerPoint Lectures forBiology, Seventh EditionNeil Campbell and Jane ReeceLectures by Chris RomeroChapter 17From Gene to Protein
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Overview: The Flow of Genetic Information• The information content of DNA– Is in the form of specific sequences ofnucleotides along the DNA strands
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• The DNA inherited by an organism– Leads to specific traits by dictating thesynthesis of proteins• The process by which DNA directs proteinsynthesis, gene expression– Includes two stages, called transcription andtranslation
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• The ribosome– Is part of the cellular machinery for translation,polypeptide synthesisFigure 17.1
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Concept 17.1: Genes specify proteins viatranscription and translation
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsEvidence from the Study of Metabolic Defects• In 1909, British physician Archibald Garrod– Was the first to suggest that genes dictatephenotypes through enzymes that catalyzespecific chemical reactions in the cell
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsNutritional Mutants in Neurospora: Scientific Inquiry• Beadle and Tatum causes bread mold tomutate with X-rays– Creating mutants that could not survive onminimal medium
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Using genetic crosses– They determined that their mutants fell into threeclasses, each mutated in a different geneFigure 17.2Working with the mold Neurospora crassa, George Beadle and Edward Tatum had isolated mutants requiringarginine in their growth medium and had shown genetically that these mutants fell into three classes, eachdefective in a different gene. From other considerations, they suspected that the metabolic pathway of argininebiosynthesis included the precursors ornithine and citrulline. Their most famous experiment, shown here,tested both their one gene–one enzyme hypothesis and their postulated arginine pathway. In this experiment,they grew their three classes of mutants under the four different conditions shown in the Results section below.The wild-type strain required only the minimal medium for growth. The three classes of mutants haddifferent growth requirementsEXPERIMENTRESULTSClass IMutantsClass IIMutantsClass IIIMutantsWild typeMinimalmedium(MM)(control)MM +OrnithineMM +CitrullineMM +Arginine(control)
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsCONCLUSION From the growth patterns of the mutants, Beadle and Tatum deduced that each mutant was unableto carry out one step in the pathway for synthesizing arginine, presumably because it lacked thenecessary enzyme. Because each of their mutants was mutated in a single gene, they concluded thateach mutated gene must normally dictate the production of one enzyme. Their results supported theone gene–one enzyme hypothesis and also confirmed the arginine pathway.(Notice that a mutant can grow only if supplied with a compound made after the defective step.)Class IMutants(mutationin gene A)Class IIMutants(mutationin gene B)Class IIIMutants(mutationin gene C)Wild typeGene AGene BGene CPrecursor Precursor Precursor PrecursorOrnithine Ornithine Ornithine OrnithineCitrulline Citrulline Citrulline CitrullineArginine Arginine Arginine ArginineEnzymeAEnzymeBEnzymeCA A AB B BC C C
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Beadle and Tatum developed the “one gene–one enzyme hypothesis”– Which states that the function of a gene is todictate the production of a specific enzyme
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsThe Products of Gene Expression: A Developing Story• As researchers learned more about proteins– The made minor revision to the one gene–oneenzyme hypothesis• Genes code for polypeptide chains or for RNAmolecules
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsBasic Principles of Transcription and Translation• Transcription– Is the synthesis of RNA under the direction ofDNA– Produces messenger RNA (mRNA)• Translation– Is the actual synthesis of a polypeptide, whichoccurs under the direction of mRNA– Occurs on ribosomes
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• In prokaryotes– Transcription and translation occur togetherFigure 17.3aProkaryotic cell. In a cell lacking a nucleus, mRNAproduced by transcription is immediately translatedwithout additional processing.(a)TRANSLATIONTRANSCRIPTIONDNAmRNARibosomePolypeptide
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• In eukaryotes– RNA transcripts are modified before becomingtrue mRNAFigure 17.3bEukaryotic cell. The nucleus provides a separatecompartment for transcription. The original RNAtranscript, called pre-mRNA, is processed in variousways before leaving the nucleus as mRNA.(b)TRANSCRIPTIONRNA PROCESSINGTRANSLATIONmRNADNAPre-mRNAPolypeptideRibosomeNuclearenvelope
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Cells are governed by a cellular chain ofcommand– DNA → RNA → protein
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsThe Genetic Code• How many bases correspond to an aminoacid?
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsCodons: Triplets of Bases• Genetic information– Is encoded as a sequence of nonoverlappingbase triplets, or codons
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• During transcription– The gene determines the sequence of basesalong the length of an mRNA moleculeFigure 17.4DNAmoleculeGene 1Gene 2Gene 3DNA strand(template)TRANSCRIPTIONmRNAProteinTRANSLATIONAmino acidA C C A A A C C G A G TU G G U U U G G C U C ATrp Phe Gly SerCodon3 535
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsCracking the Code• A codon in messenger RNA– Is either translated into an amino acid or serves asa translational stop signalFigure 17.5Second mRNA baseU C A GUCAGUUUUUCUUAUUGCUUCUCCUACUGAUUAUCAUAAUGGUUGUCGUAGUGMet orstartPheLeuLeulleValUCUUCCUCAUCGCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCGSerProThrAlaUAUUACUGUUGCTyr CysCAUCACCAACAGCGUCGCCGACGGAAUAACAAAAAGAGUAGCAGAAGGGAUGACGAAGAGGGUGGCGGAGGGUGGUAAUAG StopStop UGA StopTrpHisGlnAsnLysAspArgSerArgGlyUCAGUCAGUCAGUCAGFirstmRNAbase(5end)ThirdmRNAbase(3end)Glu
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Codons must be read in the correct readingframe– For the specified polypeptide to be produced
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsEvolution of the Genetic Code• The genetic code is nearly universal– Shared by organisms from the simplestbacteria to the most complex animals
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• In laboratory experiments– Genes can be transcribed and translated afterbeing transplanted from one species toanotherFigure 17.6
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Concept 17.2: Transcription is the DNA-directed synthesis of RNA: a closer look
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsMolecular Components of Transcription• RNA synthesis– Is catalyzed by RNA polymerase, which priesthe DNA strands apart and hooks together theRNA nucleotides– Follows the same base-pairing rules as DNA,except that in RNA, uracil substitutes forthymine
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsSynthesis of an RNA Transcript• The stages of transcription are– Initiation– Elongation– TerminationFigure 17.7PromoterTranscription unitRNA polymeraseStart point533535535335533555RewoundRNARNAtranscript33Completed RNAtranscriptUnwoundDNARNAtranscriptTemplate strand ofDNADNA1 Initiation. After RNA polymerase binds tothe promoter, the DNA strands unwind, andthe polymerase initiates RNA synthesis at thestart point on the template strand.2 Elongation. The polymerase moves downstream, unwinding theDNA and elongating the RNA transcript 5  3 . In the wake oftranscription, the DNA strands re-form a double helix.3 Termination. Eventually, the RNAtranscript is released, and thepolymerase detaches from the DNA.
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsElongationRNApolymeraseNon-templatestrand of DNARNA nucleotides3 endC A E G C AAUT A G G T TAACGUATCAT C C A ATTGG355Newly madeRNADirection of transcription(“downstream”) Templatestrand of DNA
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsRNA Polymerase Binding and Initiation of Transcription• Promoters signal the initiation of RNA synthesis• Transcription factors– Help eukaryotic RNA polymerase recognizepromoter sequencesFigure 17.8Figure 17.8TRANSCRIPTIONRNA PROCESSINGTRANSLATIONDNAPre-mRNAmRNARibosomePolypeptideT A T AAA AATAT T T TTATA box Start point TemplateDNA strand5335Transcriptionfactors5335Promoter53355RNA polymerase IITranscription factorsRNA transcriptTranscription initiation complexEukaryotic promoters1Several transcriptionfactors2Additional transcriptionfactors3
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsElongation of the RNA Strand• As RNA polymerase moves along the DNA– It continues to untwist the double helix,exposing about 10 to 20 DNA bases at a timefor pairing with RNA nucleotides
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsTermination of Transcription• The mechanisms of termination– Are different in prokaryotes and eukaryotes
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Concept 17.3: Eukaryotic cells modify RNAafter transcription• Enzymes in the eukaryotic nucleus– Modify pre-mRNA in specific ways before thegenetic messages are dispatched to thecytoplasm
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsAlteration of mRNA Ends• Each end of a pre-mRNA molecule is modifiedin a particular way– The 5′ end receives a modified nucleotide cap– The 3′ end gets a poly-A tailFigure 17.9A modified guanine nucleotideadded to the 5 end50 to 250 adenine nucleotidesadded to the 3 endProtein-coding segment Polyadenylation signalPoly-A tail3 UTRStop codonStart codon5 Cap 5 UTRAAUAAA AAA…AAATRANSCRIPTIONRNA PROCESSINGDNAPre-mRNAmRNATRANSLATIONRibosomePolypeptideG P P P5 3
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsSplit Genes and RNA Splicing• RNA splicing– Removes introns and joins exonsFigure 17.10TRANSCRIPTIONRNA PROCESSINGDNAPre-mRNAmRNATRANSLATIONRibosomePolypeptide5 CapExon Intron1530 31Exon Intron104 105 146Exon 3Poly-A tailPoly-A tailIntrons cut out andexons spliced togetherCodingsegment5 Cap1 1463 UTR3 UTRPre-mRNAmRNA
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Is carried out by spliceosomes in some casesFigure 17.11RNA transcript (pre-mRNA)Exon 1 Intron Exon 2Other proteinsProteinsnRNAsnRNPsSpliceosomeSpliceosomecomponentsCut-outintronmRNAExon 1 Exon 2555123
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsRibozymes• Ribozymes– Are catalytic RNA molecules that function asenzymes and can splice RNA
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsThe Functional and Evolutionary Importance of Introns• The presence of introns– Allows for alternative RNA splicing
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Proteins often have a modular architecture– Consisting of discrete structural and functionalregions called domains• In many cases– Different exons code for the different domains in aproteinFigure 17.12GeneDNAExon 1 Intron Exon 2 Intron Exon 3TranscriptionRNA processingTranslationDomain 3Domain 1Domain 2Polypeptide
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Concept 17.4: Translation is the RNA-directedsynthesis of a polypeptide: a closer look
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsMolecular Components of Translation• A cell translates an mRNA message intoprotein– With the help of transfer RNA (tRNA)
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Translation: the basic conceptFigure 17.13TRANSCRIPTIONTRANSLATIONDNAmRNARibosomePolypeptidePolypeptideAminoacidstRNA withamino acidattachedRibosometRNAAnticodonmRNATrpPhe GlyAG CA A ACCGU G G U U U G G CCodons5 3
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Molecules of tRNA are not all identical– Each carries a specific amino acid on one end– Each has an anticodon on the other end
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsThe Structure and Function of Transfer RNAACC• A tRNA molecule– Consists of a single RNA strand that is onlyabout 80 nucleotides long– Is roughly L-shapedFigure 17.14aTwo-dimensional structure. The four base-paired regions andthree loops are characteristic of all tRNAs, as is the base sequenceof the amino acid attachment site at the 3 end. The anticodon tripletis unique to each tRNA type. (The asterisks mark bases that havebeen chemically modified, a characteristic of tRNA.)(a)3CCACGCUUAAGACACCU*GC* *G U G U*CU* G AGGU**A*AA GUCAGACC*C G A GA G GG**GACUC*AUUUAGGCG5Amino acidattachment siteHydrogenbondsAnticodonA
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsFigure 17.14b(b) Three-dimensional structureSymbol usedin this bookAmino acidattachment siteHydrogenbondsAnticodonAnticodonA AG533 5(c)
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• A specific enzyme called an aminoacyl-tRNAsynthetase– Joins each amino acid to the correct tRNAFigure 17.15Amino acidATPAdenosinePyrophosphateAdenosineAdenosinePhosphatestRNAP P PPP PiPiPiPAMPAminoacyl tRNA(an “activatedamino acid”)Aminoacyl-tRNAsynthetase (enzyme)Active site binds theamino acid and ATP.1ATP loses two P groupsand joins amino acid as AMP.23 AppropriatetRNA covalentlyBonds to aminoAcid, displacingAMP.Activated amino acidis released by the enzyme.4
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsRibosomes• Ribosomes– Facilitate the specific coupling of tRNAanticodons with mRNA codons during proteinsynthesis
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• The ribosomal subunits– Are constructed of proteins and RNAmolecules named ribosomal RNA or rRNAFigure 17.16aTRANSCRIPTIONTRANSLATIONDNAmRNARibosomePolypeptideExit tunnelGrowingpolypeptidetRNAmoleculesEP ALargesubunitSmallsubunitmRNAComputer model of functioning ribosome. This is a model of a bacterialribosome, showing its overall shape. The eukaryotic ribosome is roughlysimilar. A ribosomal subunit is an aggregate of ribosomal RNA moleculesand proteins.(a)53
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• The ribosome has three binding sites for tRNA– The P site– The A site– The E siteFigure 17.16bE P AP site (Peptidyl-tRNAbinding site)E site(Exit site)mRNAbinding siteA site (Aminoacyl-tRNA binding site)LargesubunitSmallsubunitSchematic model showing binding sites. A ribosome has an mRNAbinding site and three tRNA binding sites, known as the A, P, and Esites. This schematic ribosome will appear in later diagrams.(b)
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsFigure 17.16cAmino end Growing polypeptideNext amino acidto be added topolypeptide chaintRNAmRNACodons35Schematic model with mRNA and tRNA. A tRNA fits into a binding site when its anticodonbase-pairs with an mRNA codon. The P site holds the tRNA attached to the growingpolypeptide. The A site holds the tRNA carrying the next amino acid to be added to thepolypeptide chain. Discharged tRNA leaves via the E site.(c)
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsBuilding a Polypeptide• We can divide translation into three stages– Initiation– Elongation– Termination
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsRibosome Association and Initiation of Translation• The initiation stage of translation– Brings together mRNA, tRNA bearing the firstamino acid of the polypeptide, and twosubunits of a ribosomeLargeribosomalsubunitThe arrival of a large ribosomal subunit completesthe initiation complex. Proteins called initiationfactors (not shown) are required to bring all thetranslation components together. GTP providesthe energy for the assembly. The initiator tRNA isin the P site; the A site is available to the tRNAbearing the next amino acid.2Initiator tRNAmRNAmRNA binding site SmallribosomalsubunitTranslation initiation complexP siteGDPGTPStart codonA small ribosomal subunit binds to a molecule ofmRNA. In a prokaryotic cell, the mRNA binding siteon this subunit recognizes a specific nucleotidesequence on the mRNA just upstream of the startcodon. An initiator tRNA, with the anticodon UAC,base-pairs with the start codon, AUG. This tRNAcarries the amino acid methionine (Met).1MetMetU A CA U GE A355335 35Figure 17.17
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsElongation of the Polypeptide Chain• In the elongation stage of translation– Amino acids are added one by one to thepreceding amino acidFigure 17.18Amino endof polypeptidemRNARibosome ready fornext aminoacyl tRNAEP AEP AEP AEP AGDPGTPGTPGDP22site site53TRANSCRIPTIONTRANSLATIONDNAmRNARibosomePolypeptideCodon recognition. The anticodonof an incoming aminoacyl tRNAbase-pairs with the complementarymRNA codon in the A site. Hydrolysisof GTP increases the accuracy andefficiency of this step.1Peptide bond formation. AnrRNA molecule of the largesubunit catalyzes the formationof a peptide bond between thenew amino acid in the A site andthe carboxyl end of the growingpolypeptide in the P site. This stepattaches the polypeptide to thetRNA in the A site.2Translocation. The ribosometranslocates the tRNA in the Asite to the P site. The empty tRNAin the P site is moved to the E site,where it is released. The mRNAmoves along with its bound tRNAs,bringing the next codon to betranslated into the A site.3
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsTermination of Translation• The final stage of translation is termination– When the ribosome reaches a stop codon inthe mRNAFigure 17.19ReleasefactorFreepolypeptideStop codon(UAG, UAA, or UGA)53 3535When a ribosome reaches a stopcodon on mRNA, the A site of theribosome accepts a protein calleda release factor instead of tRNA.1 The release factor hydrolyzesthe bond between the tRNA inthe P site and the last aminoacid of the polypeptide chain.The polypeptide is thus freedfrom the ribosome.2 3 The two ribosomal subunitsand the other components ofthe assembly dissociate.
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsPolyribosomes• A number of ribosomes can translate a singlemRNA molecule simultaneously– Forming a polyribosomeFigure 17.20a, bGrowingpolypeptidesCompletedpolypeptideIncomingribosomalsubunitsStart ofmRNA(5 end)End ofmRNA(3 end)PolyribosomeAn mRNA molecule is generally translated simultaneouslyby several ribosomes in clusters called polyribosomes.(a)RibosomesmRNAThis micrograph shows a large polyribosome in a prokaryoticcell (TEM).0.1 µm(b)
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsCompleting and Targeting the Functional Protein• Polypeptide chains– Undergo modifications after the translationprocess
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsProtein Folding and Post-Translational Modifications• After translation– Proteins may be modified in ways that affecttheir three-dimensional shape
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsTargeting Polypeptides to Specific Locations• Two populations of ribosomes are evident incells– Free and bound• Free ribosomes in the cytosol– Initiate the synthesis of all proteins
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Proteins destined for the endomembranesystem or for secretion– Must be transported into the ER– Have signal peptides to which a signal-recognition particle (SRP) binds, enabling thetranslation ribosome to bind to the ER
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsFigure 17.21RibosomemRNASignalpeptideSignal-recognitionparticle(SRP) SRPreceptorproteinTranslocationcomplexCYTOSOLSignalpeptideremovedERmembraneProteinERLUMEN• The signal mechanism for targeting proteins tothe ERPolypeptidesynthesis beginson a freeribosome inthe cytosol.1 An SRP bindsto the signalpeptide, haltingsynthesismomentarily.2 The SRP binds to areceptor protein in the ERmembrane. This receptoris part of a protein complex(a translocation complex)that has a membrane poreand a signal-cleaving enzyme.3 The SRP leaves, andthe polypeptide resumesgrowing, meanwhiletranslocating across themembrane. (The signalpeptide stays attachedto the membrane.)4 The signal-cleavingenzymecuts off thesignal peptide.5 The rest ofthe completedpolypeptide leavesthe ribosome andfolds into its finalconformation.6
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Concept 17.5: RNA plays multiple roles in thecell: a review• RNA– Can hydrogen-bond to other nucleic acidmolecules– Can assume a specific three-dimensionalshape– Has functional groups that allow it to act as acatalyst
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Types of RNA in a Eukaryotic CellTable 17.1
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Concept 17.6: Comparing gene expression inprokaryotes and eukaryotes reveals key differences• Prokaryotic cells lack a nuclear envelope– Allowing translation to begin while transcription isstill in progressFigure 17.22DNAPolyribosomemRNADirection oftranscription0.25 mRNApolymerasePolyribosomeRibosomeDNAmRNA (5 end)RNA polymerasePolypeptide(amino end)
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• In a eukaryotic cell– The nuclear envelope separates transcriptionfrom translation– Extensive RNA processing occurs in thenucleus
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Concept 17.7: Point mutations can affectprotein structure and function• Mutations– Are changes in the genetic material of a cell• Point mutations– Are changes in just one base pair of a gene
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• The change of a single nucleotide in the DNA’stemplate strand– Leads to the production of an abnormal proteinFigure 17.23In the DNA, themutant templatestrand has an A wherethe wild-type templatehas a T.The mutant mRNA hasa U instead of an A inone codon.The mutant (sickle-cell)hemoglobin has a valine(Val) instead of a glutamicacid (Glu).Mutant hemoglobin DNAWild-type hemoglobin DNAmRNA mRNANormal hemoglobin Sickle-cell hemoglobinGlu ValC T T C A TG A A G U A3 5 3 55 35 3
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsTypes of Point Mutations• Point mutations within a gene can be dividedinto two general categories– Base-pair substitutions– Base-pair insertions or deletions
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsSubstitutions• A base-pair substitution– Is the replacement of one nucleotide and itspartner with another pair of nucleotides– Can cause missense or nonsenseFigure 17.24Wild typeA U G A A G U U U G G C U A AmRNA5Protein Met Lys Phe Gly StopCarboxyl endAmino end3A U G A A G U U U G G U U A AMet Lys Phe GlyBase-pair substitutionNo effect on amino acid sequenceU instead of CStopA U G A A G U U U A G U U A AMet Lys Phe Ser StopA U G U A G U U U G G C U A AMet StopMissense A instead of GNonsenseU instead of A
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsInsertions and Deletions• Insertions and deletions– Are additions or losses of nucleotide pairs in agene– May produce frameshift mutationsFigure 17.25mRNAProteinWild typeA U G A A G U U U G G C U A A5Met Lys Phe GlyAmino end Carboxyl endStopBase-pair insertion or deletionFrameshift causing immediate nonsenseA U G U A A G U U U G G C U AA U G A A G U U G G C U A AA U G U U U G G C U A AMet StopUMet Lys Leu AlaMet Phe GlyStopMissingA A GMissingExtra UFrameshift causingextensive missenseInsertion or deletion of 3 nucleotides:no frameshift but extra or missing amino acid3
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsMutagens• Spontaneous mutations– Can occur during DNA replication,recombination, or repair
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• Mutagens– Are physical or chemical agents that cancause mutations
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin CummingsWhat is a gene? revisiting the question• A gene– Is a region of DNA whose final product is eithera polypeptide or an RNA molecule
    • Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings• A summary of transcription and translation in aeukaryotic cellFigure 17.26TRANSCRIPTIONRNA is transcribedfrom a DNA template.DNARNApolymeraseRNAtranscriptRNA PROCESSINGIn eukaryotes, theRNA transcript (pre-mRNA) is spliced andmodified to producemRNA, which movesfrom the nucleus to thecytoplasm.ExonPoly-ARNA transcript(pre-mRNA)IntronNUCLEUSCapFORMATION OFINITIATION COMPLEXAfter leaving thenucleus, mRNA attachesto the ribosome.CYTOPLASMmRNAPoly-AGrowingpolypeptideRibosomalsubunitsCapAminoacyl-tRNAsynthetaseAminoacidtRNAAMINO ACID ACTIVATIONEach amino acidattaches to its proper tRNAwith the help of a specificenzyme and ATP.Activatedamino acidTRANSLATIONA succession of tRNAsadd their amino acids tothe polypeptide chainas the mRNA is movedthrough the ribosomeone codon at a time.(When completed, thepolypeptide is releasedfrom the ribosome.)AnticodonA CCA A AUG GUU UA U GUACE ARibosome1Poly-A553Codon23 45