DNAdigest Eagle Genomics Symposium March 27, 2014

383 views
333 views

Published on

At the Eagle Genomics Symposium Fiona Nielsen CEO and founder of DNAdigest presented a discussion of the trade-off between privacy and open access and how hard-to-access data is hindering progress in genetics research.

Read more at http://DNAdigest.org and have a look at our campaign in support of collaborative open science for human genetics: http://tiny.cc/funddna <-- this is where you can get one of those cool #OpenScience T-shirts ;)

Published in: Data & Analytics
0 Comments
2 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
383
On SlideShare
0
From Embeds
0
Number of Embeds
61
Actions
Shares
0
Downloads
3
Comments
0
Likes
2
Embeds 0
No embeds

No notes for slide
  • The data tsunami. That’s us!
  • Latest prediction for 2015 based on the capacity of the planned delivery of HiSeqX systems for human genomes. Don’t panic!
  • Promises of genomic medicine
  • Rosy picture breaks when you cannot make sense of the data
  • There is no limit to the number of data analysis programs available, but there is a serious bottleneck in access to data for comparison, filtering and testing of hypotheses
  • Clinical pilot studies: max 25% WES and WGS enable diagnosisLittle overlap between interpretation, conclusion of different labs looking at the same dataClearly we are in an unwanted situation. Why is no more data available to provide evidence-based results?
  • Trade-off: details are necessary for data re-use!Advantage: access to complete datasets of genetics and medical dataDisadvantage: cumbersome, timeconsuming and slow processing of application for accessDisadvantage: difficult to discover the data you need
  • Not easy to discover dataNot easy to apply for access to dataNot easy to deal with bulk datasetsAs a consequence:Researchers do not cross-check their resultsData is not re-used for analysisResearchers duplicate existing workResults are published based on small sample sizeswhere
  • Collaborative approach
  • Collaborative approach
  • Allow more knowledge to be generated from data
  • Create new hope for genetic research
  • DNAdigest Eagle Genomics Symposium March 27, 2014

    1. 1. Secure the data – share the knowledge Fiona Nielsen, DNAdigest founder and CEO Eagle Genomics Symposium 2014.org
    2. 2. !
    3. 3. CATTATGCCAGAAGTAGAATGAGGTGGTGCAACAGTATAACCCTAACCCTAACCCTAACCCTAAC CCTAACCCTCTGAAAGTGGACCTATCAGCAGGATGTGGGTGGGAGCAGATTAGAGAATAAAAGCA GACTGCCTGAGCCAGCAGTGGCAACCCAATGGGGTCCCTTTCCATACTGTGGAAGCTTCGTTCTT TCACTCTTTGCAATAAATCTTGCTATTGCTCACTCTTTGGGTCCACACTGCCTTTATGAGCTGTG ACACTCACCGCAAAGGTCTGCAGCTTCACTCCTGAGCCAGTGAGACCACAACCCCACCAGAAAGA AGAAACTCAGAACACATCTGAACATCAGAAGAAACAAACTCCGGACGCGCCACCTTTAAGAACTG TAACACTCACCGCGAGGTTCCGCGTCTTCATTCTTGAAGTCAGTGAGACCAAGAACCCACCAATT CCAGACACACTAGGACCCTGAGACAACCCCTAGAAGAGCACCTGGTTGATAACCCAGTTCCCATC TGGGATTTAGGGGACCTGGACAGCCCGGAAAATGAGCTCCTCATCTCTAACCCAGTTCCCCTGTG GGGATTTAGGGGACCAGGGACAGCCCGTTGCATGAGCCCCTGGACTCTAACCCAGTTCCCTTCTG GAATTTAGGGGCCCTGGGACAGCCCTGTACATGAGCTCCTGGTCTGTAACACAGTTCCCCTGTGG GGATTTAGGGACTTGGGCCTTCTGTCTTTGGGATCTACTCTCTATGGGCCACACAGATATGTCTT CCAACTTCCCTACACAGGGGGGACTTCAAAGAGTGCCTTGAGCTGATCTGGTGATTGCTTTTTTG TACTGTTATTTATCTTATTCTTTTCATTGTGAGGTACTGATGCAAACACTTTGTACGAAAAGGTC TTTCTCATCTCGGGAGTCCCCGTCTATTTGTCCCGGTCCCTGTTAACCCAGTCCCCGACAGGAGC CCCTTCTGCACCTTGAGCTCTCACCACTCACCGTCCATCCAGCCCCAGCTCTGCCTGCAACCCAC CCATCCCTGGGACTCGGGCCTCCCCTCTCTAGTGGTCTGGTCATCAGGCCAGGGGCACGTGGAAG AAGCTATCGTGGCAAAGGGAGCAGTCATATCCCCAAAATCTGTGGTTGGTTTACCACCACCATGG AAACCCCAGGGTGGGACTCTAGTTTCAGGTTGGAGCTGAGCCCTGTCGGGAATGAGCTTTCCCCA GCTATGGCTTCTTGGGGCCCCTGTGCCCTGAGCTGTGTCTCCCAGCATCGGGTCCCCACCATGCA TATGGCCCACTCAGGCACAGTGCCGCGATGGCTGCATGCGTGAGGGGGGCCTGGGCCCAGGGCTG GGAGTCCTTTGTGTCTCATGGCCATGATTGTCCTTCCGAGTATGATATGGTGGCCAATTTCTTTT ATTCTGTCGTTCAGAGTGAGTAAATGATGTAGAGTTCATGCAGAAAAAAATACAACAAAAACCAA GGGAACATAGAATTGGAAAACGCGTCACAGCAATGAGTTAAATAGGTAACAAATTTCATCATTTG AAGAAAGACTTAGAGTGCCAAAAGTGCCTCTTAAGTCTCCTTTAAAAAGTAGCAAAATTCATCCC
    4. 4. CATTATGCCAGAAGTAGAATGAGGTGGTGCAACAGTATAACCCTAACCCTAACCCTAACCCTAAC CCTAACCCTCTGAAAGTGGACCTATCAGCAGGATGTGGGTGGGAGCAGATTAGAGAATAAAAGCA GACTGCCTGAGCCAGCAGTGGCAACCCAATGGGGTCCCTTTCCATACTGTGGAAGCTTCGTTCTT TCACTCTTTGCAATAAATCTTGCTATTGCTCACTCTTTGGGTCCACACTGCCTTTATGAGCTGTG ACACTCACCGCAAAGGTCTGCAGCTTCACTCCTGAGCCAGTGAGACCACAACCCCACCAGAAAGA AGAAACTCAGAACACATCTGAACATCAGAAGAAACAAACTCCGGACGCGCCACCTTTAAGAACTG TAACACTCACCGCGAGGTTCCGCGTCTTCATTCTTGAAGTCAGTGAGACCAAGAACCCACCAATT CCAGACACACTAGGACCCTGAGACAACCCCTAGAAGAGCACCTGGTTGATAACCCAGTTCCCATC TGGGATTTAGGGGACCTGGACAGCCCGGAAAATGAGCTCCTCATCTCTAACCCAGTTCCCCTGTG GGGATTTAGGGGACCAGGGACAGCCCGTTGCATGAGCCCCTGGACTCTAACCCAGTTCCCTTCTG GAATTTAGGGGCCCTGGGACAGCCCTGTACATGAGCTCCTGGTCTGTAACACAGTTCCCCTGTGG GGATTTAGGGACTTGGGCCTTCTGTCTTTGGGATCTACTCTCTATGGGCCACACAGATATGTCTT CCAACTTCCCTACACAGGGGGGACTTCAAAGAGTGCCTTGAGCTGATCTGGTGATTGCTTTTTTG TACTGTTATTTATCTTATTCTTTTCATTGTGAGGTACTGATGCAAACACTTTGTACGAAAAGGTC TTTCTCATCTCGGGAGTCCCCGTCTATTTGTCCCGGTCCCTGTTAACCCAGTCCCCGACAGGAGC CCCTTCTGCACCTTGAGCTCTCACCACTCACCGTCCATCCAGCCCCAGCTCTGCCTGCAACCCAC CCATCCCTGGGACTCGGGCCTCCCCTCTCTAGTGGTCTGGTCATCAGGCCAGGGGCACGTGGAAG AAGCTATCGTGGCAAAGGGAGCAGTCATATCCCCAAAATCTGTGGTTGGTTTACCACCACCATGG AAACCCCAGGGTGGGACTCTAGTTTCAGGTTGGAGCTGAGCCCTGTCGGGAATGAGCTTTCCCCA GCTATGGCTTCTTGGGGCCCCTGTGCCCTGAGCTGTGTCTCCCAGCATCGGGTCCCCACCATGCA TATGGCCCACTCAGGCACAGTGCCGCGATGGCTGCATGCGTGAGGGGGGCCTGGGCCCAGGGCTG GGAGTCCTTTGTGTCTCATGGCCATGATTGTCCTTCCGAGTATGATATGGTGGCCAATTTCTTTT ATTCTGTCGTTCAGAGTGAGTAAATGATGTAGAGTTCATGCAGAAAAAAATACAACAAAAACCAA GGGAACATAGAATTGGAAAACGCGTCACAGCAATGAGTTAAATAGGTAACAAATTTCATCATTTG AAGAAAGACTTAGAGTGCCAAAAGTGCCTCTTAAGTCTCCTTTAAAAAGTAGCAAAATTCATCCC
    5. 5. CATTATGCCAGAAGTAGAATGAGGTGGTGCAACAGTATAACCCTAACCCTAACCCTAACCCTAAC CCTAACCCTCTGAAAGTGGACCTATCAGCAGGATGTGGGTGGGAGCAGATTAGAGAATAAAAGCA GACTGCCTGAGCCAGCAGTGGCAACCCAATGGGGTCCCTTTCCATACTGTGGAAGCTTCGTTCTT TCACTCTTTGCAATAAATCTTGCTATTGCTCACTCTTTGGGTCCACACTGCCTTTATGAGCTGTG ACACTCACCGCAAAGGTCTGCAGCTTCACTCCTGAGCCAGTGAGACCACAACCCCACCAGAAAGA AGAAACTCAGAACACATCTGAACATCAGAAGAAACAAACTCCGGACGCGCCACCTTTAAGAACTG TAACACTCACCGCGAGGTTCCGCGTCTTCATTCTTGAAGTCAGTGAGACCAAGAACCCACCAATT CCAGACACACTAGGACCCTGAGACAACCCCTAGAAGAGCACCTGGTTGATAACCCAGTTCCCATC TGGGATTTAGGGGACCTGGACAGCCCGGAAAATGAGCTCCTCATCTCTAACCCAGTTCCCCTGTG GGGATTTAGGGGACCAGGGACAGCCCGTTGCATGAGCCCCTGGACTCTAACCCAGTTCCCTTCTG GAATTTAGGGGCCCTGGGACAGCCCTGTACATGAGCTCCTGGTCTGTAACACAGTTCCCCTGTGG GGATTTAGGGACTTGGGCCTTCTGTCTTTGGGATCTACTCTCTATGGGCCACACAGATATGTCTT CCAACTTCCCTACACAGGGGGGACTTCAAAGAGTGCCTTGAGCTGATCTGGTGATTGCTTTTTTG TACTGTTATTTATCTTATTCTTTTCATTGTGAGGTACTGATGCAAACACTTTGTACGAAAAGGTC TTTCTCATCTCGGGAGTCCCCGTCTATTTGTCCCGGTCCCTGTTAACCCAGTCCCCGACAGGAGC CCCTTCTGCACCTTGAGCTCTCACCACTCACCGTCCATCCAGCCCCAGCTCTGCCTGCAACCCAC CCATCCCTGGGACTCGGGCCTCCCCTCTCTAGTGGTCTGGTCATCAGGCCAGGGGCACGTGGAAG AAGCTATCGTGGCAAAGGGAGCAGTCATATCCCCAAAATCTGTGGTTGGTTTACCACCACCATGG AAACCCCAGGGTGGGACTCTAGTTTCAGGTTGGAGCTGAGCCCTGTCGGGAATGAGCTTTCCCCA GCTATGGCTTCTTGGGGCCCCTGTGCCCTGAGCTGTGTCTCCCAGCATCGGGTCCCCACCATGCA TATGGCCCACTCAGGCACAGTGCCGCGATGGCTGCATGCGTGAGGGGGGCCTGGGCCCAGGGCTG GGAGTCCTTTGTGTCTCATGGCCATGATTGTCCTTCCGAGTATGATATGGTGGCCAATTTCTTTT ATTCTGTCGTTCAGAGTGAGTAAATGATGTAGAGTTCATGCAGAAAAAAATACAACAAAAACCAA GGGAACATAGAATTGGAAAACGCGTCACAGCAATGAGTTAAATAGGTAACAAATTTCATCATTTG AAGAAAGACTTAGAGTGCCAAAAGTGCCTCTTAAGTCTCCTTTAAAAAGTAGCAAAATTCATCCC
    6. 6. Why is no more data available to provide evidence-based results?
    7. 7. Data Privacy vs Data Access Restricted access repositories Open access • Time-consuming deposit • Time-consuming access • Difficult to discover data • Requires consent for open access (PGP) or • Details removed (1k genomes)
    8. 8. deadlock
    9. 9. • Data discovery • Data access • Incentives You are invited!
    10. 10. • Connectivity • Aggregation • Immediate access
    11. 11. DEMO
    12. 12. Secure the data – share the knowledge @DNAdigest Support our work at http://tiny.cc/funddna .org

    ×