Herencia mendeliana

5,364 views
4,994 views

Published on

1 Comment
2 Likes
Statistics
Notes
  • Hay un error, en la diapositiva 4 : Loci es el plural de lucus , no al revés
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
No Downloads
Views
Total views
5,364
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
69
Comments
1
Likes
2
Embeds 0
No embeds

No notes for slide

Herencia mendeliana

  1. 1. 1/2 A 1/2 a AA Aa Aa HERENCIA MENDELIANA 1/2 a EXPERIMENTOS, LEYES DE MENDEL aa 1/2 A Razón genotípica 1/4 AA 1/2 Aa 1/4 aa Razón fenotípica 3/4 A1/4 aa Tema 3: Principios mendelianos y extensiones 1
  2. 2. Monje austriaco Gregor Mendel (1822-1884) Jardín del monasterio agustino de Santo Tomás de Brunn, actual república Checa, donde Mendel realizó sus experimentos de cruces con el guisante Tema 3: Principios mendelianos y extensiones Mendel Web: http://www.mendelweb.org/ 2
  3. 3. Terminologia Mendeliana Gen--Las unidades de la herencia que transmiten la información de los padres a la descendencia. Cromosomas--Una larga hebra de asociación de genes en el núcleo de todas las celulas eucariotas que son visibles durante la meiosis y la mitosis. Un cromosoma consta de DNA y proteínas. Un organismo siempre tiene 2n cromosomas, lo que significa que todos los cromosomas están apareados.
  4. 4. Loci.-lugar que ocupa un gen en el cromosoma Locus.- plural de loci Genotipo--Es la construcción genética de un organismo: los genes. Fenotipo--Los rasgos físicos y fisiológicos de un organismo. Ellos son influenciados por la construcción genética (los genes)y cosas parecidas. Alelo--Otra palabra para gen. Cada cromosoma tiene una copia de este alelo, es decir, un par de genes.
  5. 5. • Homocigoto--Este termino indica que un organismo tiene dos alelos idénticos en el mismo lugar en un cromosoma. Esto da como resultado un organismo que traspasa a sus crías esa característica. • Heterocigoto--Este termino indica que un organismo tiene dos copias diferentes de un gen en cada cromosoma. • Gen dominante--En un heterocigoto, este alelo(gen)esta expresado completamente en un fenotipo. En términos genéticos, estos genes están representados siempre con letras mayúsculas. • Gen recesivo--En un heterocigoto, este alelo(gen)esta completamente enmascarado en el fenotipo. En términos genéticos, estos genes son siempre representados con letras minúsculas.
  6. 6. • Alelos múltiples Existen caracteres que vienen determinados por más de dos alelos, pero los individuos presentan sólo dos de ellos ocupando los locus correspondientes en los cromosomas. • Herencia intermedia: es la mezcla de los dos caracteres en la expresión. Ej: -->Flor Roja + Blanca = Rosa. • Codominancia: comparten dominancia. Ambos alelos se expresan, pero independientemente. Ej: Flor Roja + Blanca = Roja y Blanca (un color haría de fondo y el otro serían manchas) • Autosomas.− Los cromosomas que no son sexuales. En los individuos de sexo masculino, o femenino tienen 22 pares de autosomas idénticos morfológicamente • Cromosomas sexuales, alosomas ó gonosomas.− Cromosomas que rigen la determinación del sexo, en la especie humana; XY en el varón y XX en la mujer.
  7. 7. • Cariotipo.− Conjunto de características que se toman en cuenta para identificar un juego cromosomico en particular. Visibilidad de cromosomas durante la metaface; tamaño comparativo, forma y morfología de los distintos cromosomas. • • • • • • • P1.- Línea parental o Progenitores. F1.- Primera generación filial F2.- Segunda generación filial ( F1XF1) Proporción Genotípica.-relación existente de genotipos iguales o diferentes observados en una progenie. • • Proporción Fenotípica.- relación existente de fenotipos iguales o diferentes observados en una progenie. •
  8. 8. Los experimentos de Mendel demuestran que: •La herencia se transmite por elementos particulados (no herencia de las mezclas), y •sigue normas estadísticas sencillas, resumidas en sus dos principios 8
  9. 9. Características del experimento de Mendel : •Elección de caracteres cualitativos (alto-bajo, verde-amarillo, rugoso-liso, ...) •Cruces genéticos de líneas puras (línea verde x línea amarilla) •Análisis cuantitativos de los fenotipos de la descendencia (proporción de cada fenotipo en la descendencia) 9
  10. 10. Flor de la planta del guisante, Pisum sativum estudiada por Mendel 10
  11. 11. Los siete caracteres estudiados por Mendel 12
  12. 12. Polinización cruzada Autofecundación Método de cruzamiento empleado por Mendel 13
  13. 13. Resultados de todos los cruzamientos monohíbridos de Mendel Fenotipo parental 1. Semilla lisa x rugosa 2. Semilla amarilla x verde 3. Pétalos púrpuras x blancos 4. Vaina hinchada x hendida 5. Vaina verde x amarilla 6. Flores axiales x terminales 7. Tallo largo x corto F1 F2 Relación F2 Todas lisas Todas amarillas 5474 lisas; 1850 rugosas 6022 amarillas; 2001 verdes 2,96:1 3,01:1 Todas púrpuras 705 púrpuras; 224 blancos 3,15:1 Todas hinchadas 882 hinchadas; 299 hendidas 2,95:1 Todas verdes Todas axiales 428 verdes; 152 amarillas 651 axiales; 207 terminales 2,82:1 3,14:1 Todos largos 787 largos; 277 cortos 2,84 1 14
  14. 14. Primer Grupo de experimentos: • Mendel trabajando con una variedad pura de plantas de guisantes que producían las semillas amarillas y con una variedad que producía las semillas verdes. Al hacer un cruzamiento entre estas plantas, obtenía siempre plantas con semillas amarillas. • Y LLEGA A LA CONCLUSION DE QUE: • El polen de la planta progenitora aporta a la descendencia un alelo para el color de la semilla, y el óvulo de la otra planta progenitora aporta el otro alelo para el color de la semilla ; de los dos alelos, solamente se manifiesta aquél que es dominante (A), mientras que el recesivo (a) permanece oculto.
  15. 15. Segundo Grupo de experimentos: • Mendel tomó plantas procedentes de las semillas de la primera generación (F1) del experimento anterior (figura 1) y las polinizó entre sí. Del cruce obtuvo semillas amarillas y verdes en la proporción que se indica en la figura 3. Así pues, aunque el alelo que determina la coloración verde de las semillas parecía haber desaparecido en la primera generación filial, vuelve a manifestarse en esta segunda generación. • Los dos alelos distintos para el color de la semilla presentes en los individuos de la primera generación filial, no se han mezclado ni han desaparecido, simplemente ocurría que se manifestaba sólo uno de los dos. Cuando el individuo de fenotipo amarillo y genotipo Aa, forme los gametos, se separan los alelos, de tal forma que en cada gameto sólo habrá uno de los alelos y así puede explicarse los resultados obtenidos.
  16. 16. Tercer Grupo de experimentos: Retrocruzamiento o Cruce de Prueba • En el caso de los genes que manifiestan herencia dominante, no existe ninguna diferencia aparente entre los individuos heterocigóticos (Aa) y los homocigóticos (AA), pues ambos individuos presentarían un fenotipo amarillo. • La prueba del retrocruzamiento, o simplemente cruzamiento prueba, sirve para diferenciar el individuo homocigoto del heterocigótico. Consiste en cruzar el fenotipo dominante con la variedad homocigota recesiva (aa).
  17. 17. Interpretación genética del cruce monohíbrido de Mendel 18
  18. 18. Primera ley de Mendel: Segregación equitativa Los dos miembros de un par de alelos segregan en proporciones 1:1. La mitad de los gametos lleva un alelo y la otra mitad el otro alelo Razón genotípica 1/2 A 1/2 a 1/2 A AA Aa 1/2 a Aa aa 1/4 AA 1/2 Aa 1/4 aa Razón fenotípica 3/4 A1/4 aa 19
  19. 19. Segunda ley de Mendel: Transmisión independiente Durante la formación de los gametos la segregación de alelos de un gen es independiente de la segregación de los alelos en el otro gen 20
  20. 20. Segunda ley de Mendel: Cruce dihíbrido El cuadrado de Punnett ilustra los genotipos que dan lugar a las proporciones 9:3:3:1 21
  21. 21. Cruce dihíbrido Gen Color Y (amarillo) > y (verde) Gen textura semilla R (liso) > r (rugoso) 22
  22. 22. Segunda ley de Mendel: 1/4 AB 1/4 Ab 1/4 aB 1/4 ab 1/4 AB AABB AAbB AaBB AaBb 1/4 Ab AABb AAbb AabB Aabb 1/4 aB AaBB AaBb aaBB AaBb Aabb aaBb AABB Aabb aaBB 1/16:1/16:1/16: aabb AaBb AABb 1/16:4/16:2/16: aaBb AaBB Aabb 2/16:2/16:2/16 aaBb 1/4 ab Razón genotípica aabb Razón fenotípica 9/16 A-B- 3/16 A-bb 3/16 aaB- 1/16 aabb 23
  23. 23. Cruzamientos trihibridos y otros polihibridos • • • • • • • Cuando se cruzan entre sí individuos homocigotas que difieren en tres pares de factores, el híbrido resultante se llama trihíbrido.En general, se denominan polihíbridos a los heterocigotas un numero n de pares alelomóficos. Lo señalado para la herencia de un dihíbrido puede ser aplicados a 3 o más pares de caracteres, pues la ley de pureza de las gametas, también se aplica. Método de la Línea Bifurcada o Bifurcación de Línea: Se aplica para determinar el número y tipo de genotipos y fenotipos de cruces que involucran 3 o mas pares de genes. Se utiliza las proporciones genotípicas y fenotipicas resultantes en un cruce monohibrido. Determinación de Genotipos: se utiliza la proporción de 1:2:1 en cada par de genes que a su vez se ira bifurcando con la misma proporción en el segundo par y así sucesivamente. Determinación de Fenotipos: se utiliza la proporción de 3:1 en cada par de genes que a su vez se ira bifurcando con la misma proporción en el segundo par y así sucesivamente.
  24. 24. CUADRADO DE PUNNETT • Las reglas de la probabilidad se pueden usar para ayudar a predecir los resultados de cruces genéticos simples. • Un método para calcular probabilidades es hacer lo que se llama un cuadrado de Punnett. • Un cuadrado de Punnett es una tabla que presenta las combinaciones posibles de genes en la progenie de un cruce. • El cuadrado se llama así porque el genetista R.C. Punnett fue el primero en sugerir que se usara.
  25. 25. Cómo preparar un cuadro de Punnett • El resultado de un cruce de plantas puras RR x rr de guisantes de flor roja y plantas puras de Línea pura de Línea pura de plantas de plantas de guisantes de flor guisantes de guisantes de blanca se puede flor roja flor blanca representar de la siguiente manera:
  26. 26. R R 1. En la parte de arriba de la tabla escribe sobre las columnas las letras que representan los gametos que produce un padre. La parte superior de la tabla muestra que un gameto tiene probabilidad de ½ de recibir uno de los genes R de un padre de flor roja y una probabilidad de ½ de recibir el otro gene R.
  27. 27. 2. Las letras que representan los gametos que produce el otro padre se escriben al lado de las filas, a la izquierda de la tabla. Observa que los gametos producidos por el padre de flor blanca tienen probabilidad de ½ de que uno reciba cualquiera de los genes r. R r r R
  28. 28. 3. Los cuadrados del interior de la tabla deben ilustrar qué genotipos pueden resultar al combinarse los gametos en la fecundación. En cada cuadrado, se escriben las letras para los gametos que están arriba y a la izquierda de ese cuadrado. Las combinaciones de letras en los cuadrados muestran todos los genotipos posibles en la progenie de ese cruce. Puedes ver que los genotipos de todos los individuos de la F1 son iguales. Todas las plantas de la F1, o sea el 100%, tienen el genotipo heterocigótico Rr. R R r Rr Rr r Rr Rr
  29. 29. 4. Los cuadrados interiores ayudan también a ilustrar la razón de fenotipos que se obtendrá al hacer un cruce. Como el genotipo Rr solamente produce plantas con flores rojas, el 100% de las plantas de F1 debe expresar el fenotipo dominante. R R r Rr Rr r Rr Rr
  30. 30. ¿Encontró Mendel solo el fenotipo dominante en la progenie de la F1 en cada uno de sus cruces?
  31. 31. R r Rr R Rr = r Rr Rr
  32. 32. F1: Rr x Rr Padre híbrido Padre híbrido de flores de flores rojas rojas Generación F2 • El cuadrado de Punnett también puede mostrar las probabilidades de obtener ciertos fenotipos y genotipos en la generación F2. • Observa que la proporción de los genotipos resultantes es ¼ RR, ½ Rr y ¼ rr. R R r RR R Rr R = r Rr rr r r
  33. 33. • Tanto el genotipo RR como el Rr producen plantas de flores rojas. Así que la razón de los fenotipos en la generación F2 debe ser de tres plantas de flores rojas a una de flores blancas. ¿Fue esto lo que observó Mendel? Razón genotípica = ¼ RR : ½ Rr : ¼ rr Razón fenotípica = ¾ flores rojas: ¼ flores blancas
  34. 34. Cruce de Prueba • Mendel llegó a la conclusión de que todas las plantas de flores rojas en la generación F1 tenían en genotipo Rr. • También asumió que el genotipo de todas las plantas de flores blancas era rr. • Predijo, pues, que un cruce entre las plantas de la F1 (Rr) con plantas de flores blancas (rr) debería producir casi un número igual de plantas de flores rojas que de plantas de flores blancas. • Eso fue lo que obtuvo en su experimento. El cruce que hizo mendel del híbrido de la F1 con un homocigótico recesivo fue un cruce de prueba.
  35. 35. Cruce de Prueba Rr Planta de flores rojas X rr Planta de flores blancas • Un cruce entre un ser viviente que muestra el fenotipo dominante, pero de genotipo incierto, y un ser viviente que es homocigótico recesivo, se llama un cruce de prueba. r R r Rr R Rr r R = r rr rr r Razón genotípica = ½ Rr : ½ rr Razón fenotípica = ½ flores rojas : ½ flores blancas
  36. 36. Segunda ley de Mendel: Cruce trihíbrido P AABBCC x aabbcc F1 AaBbCc x AaBbCc ABC ABc AbC Abc aBC aBc abC abc ABC AABBCC AABBCc AABbCC AABbCc AaBBCC AaBBCc AaBbCC AaBbCc ABc AABBCc AABBcc AABbCc AABbcc AaBBCc AaBbCc AaBbcc AbC AABbCC AABbCc AAbbCC AAbbCc AaBbCC AaBbCc AabbCC AabbCc Abc AABbCc AABbcc AAbbCc AAbbcc AaBbCc AaBbcc AabbCc Aabbcc aBC AaBBCC AaBBCc AaBbCC AaBbCc aaBBCC aaBBCc aaBbCC aaBbCc aBc AaBBCc AaBBcc AaBbCc AaBbcc aaBBCc aaBBcc aaBbCc aaBbcc abC AaBbCC AaBbCc AabbCC AabbCc aaBbCC aaBbCc aabbCC aabbCc abc AaBbCc AaBbcc AabbCc Aabbcc aaBbCc aaBbcc aabbCc aabbcc AaBBcc 37
  37. 37. Segunda ley de Mendel: Cruce trihíbrido P F1 ABC AABBCC x aabbcc AaBbCc x AaBbCc ABc AbC Abc aBC aBc abC abc ABC AABBCC AABBCc AABbCC AABbCc AaBBCC AaBBCc AaBbCC AaBbCc AABBCc AABBcc AABbCc AABbcc AaBBCc AaBBcc AaBbCc AaBbcc AbC AABbCC AABbCc AAbbCC AAbbCc AaBbCC AaBbCc AabbCC AabbCc Abc AABbCc AABbcc AAbbCc AAbbcc AaBbCc AaBbcc AabbCc Aabbcc aBC AaBBCC AaBBCc AaBbCC AaBbCc aaBBCC aaBBCc aaBbCC aaBbCc aBc AaBBCc AaBBcc AaBbCc AaBbcc aaBBCc aaBBcc aaBbCc aaBbcc abC AaBbCC AaBbCc AabbCC AabbCc aaBbCC aaBbCc aabbCC aabbCc abc AaBbCc AaBbcc AabbCc Aabbcc aaBbCc aaBbcc aabbCc aabbcc 3 3 1 ABc Relacion fenotípica 27 9 9 Tema 3: Principios mendelianos y 9 extensiones3 38
  38. 38. Naturaleza probabilística de las leyes Mendel: Las leyes son probabilísticas (como si los alelos de los genes se cogieran al azar de urnas), no deterministas •Permiten predecir la probabilidad de los distintos genotipos y fenotipos que resultan de un cruce •Permiten inferir el número de genes que influyen sobre un carácter 39
  39. 39. Caracteres mendelianos en humanos: •Capacidad de sentir el sabor de la feniltiocarbamida •Albinismo •Tipo sanguíneo •Braquidactilia (dedos de manos y pies cortos) •Hoyuelos de la mejilla •Lóbulos oreja sueltos o adosados •Pecas en la cara •Pulgar hiperlaxo •Polidactilia OMIM - Online Mendelian Inheritance in Man http://www.ncbi.nlm.nih.gov/sites/entrez?db=OMIM 40
  40. 40. Caracteres mendelianos Albinismo 41
  41. 41. VARIACIONES DE LAS LEYES MENDELIANAS
  42. 42. Alelismo múltiple • Grupos AB0 •A=B>0 •Fenotipo Genotipo AAA ó A0 BBB ó B0 AB AB 0 00 •Color pelaje conejo C+ > Cch > Ch > c C+ Salvaje Cch Chinchilla Ch Himalaya c albino 43
  43. 43. Alelismo múltiple A nivel de secuencia nucleotídica prácticamente cada copia de un gen es diferente en algún nucleótido de su secuencia. El alelismo múltiple es ubicuo. BRCA2 Individual Individual Individual Individual Individual Individual Individual Individual Individual 1 2 3 4 5 6 7 8 9 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag acgtagcatcgtatgcgttagacggggtggtagcaccagtacag acgtagcatcgtatgcgttagacggcggggtagcaccagtacag acgtagcatcgtttgcgttagacgggggggtagcaccagtacag acgtagcatcgtttgcgttagacgggggggtagcaccagtacag acgtagcatcgtttgcgttagacggcatggcaccggcagtacag acgtagcatcgtttgcgttagacggcatggcaccggcagtacag acgtagcatcgtttgcgttagacggcatggcaccggcagtacag acgtagcatcgtttgcgttagacggcatggcaccggcagtacag 44
  44. 44. Alelo A Secuencia 11 Secuencia 22 Secuencia 33 Se usa la notación AA, Aa y aa para denominar a los genotipos mendelianos que determinan un fenotipo, pero en realidad éstos son internamente heterogéneos en el nivel de DNA. Su asignación como genotipo AA ó aa se debe generalmente a que todas las secuencias que pertenecen al genotipo AA comparten un fenotipo distinto de los que pertenecen al genotipo aa y esta diferencia fenotípica se debe posiblemente a un (o a unos pocos) nucleótido que sería el verdadero genotipo que causa los diferentes fenotipos acgtagcatcgtatgcgttagacgggggggtagcaccagtacag acgtagcatcgtatgcgttagacggggtggtagcaccagtacag acgtagcatcgtatgcgttagacggcggggtagcaccagtacag Alelo a Secuencia 4 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag Secuencia 5 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag Secuencia 6 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Secuencia 7 7 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Secuencia 88 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Secuencia 9 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag 45
  45. 45. •Gen letal y esencial •Un gen que cuando está alterado es letal, es un gen esencial •Gen y del ratón doméstico es un ejemplo Alelo y es dominante para el color amarillo, letal en homocigosis. Alteración proporciones mendelianas de la F2 es 2:1 46

×