Janzen ecn2013
Upcoming SlideShare
Loading in...5
×
 

Janzen ecn2013

on

  • 232 views

 

Statistics

Views

Total Views
232
Views on SlideShare
232
Embed Views
0

Actions

Likes
0
Downloads
1
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment
  • C:\Documents and Settings\Owner\Desktop\19122008 - am\01122008\Jose planning - churchill microgastrinae\PatelloaxanthuraDHJ01-DHJPAR000352911112008.FAS

Janzen ecn2013 Janzen ecn2013 Presentation Transcript

  • We are developers of tropical real estate.
  • Our clients:
  • Costa Rica Pacific Area de Conservación Guanacaste (ACG)
  • ACG: 15,000 SPECIES OF LEPIDOPTERA; 5,000 FOOD PLANTS; 4,000 PARASITOIDS rain forest cloud forest dry forest marine Pacific Ocean 1,200 KM2 LAND: PHILADELPHIA AND SUBURBS
  • Adding DNA barcoding to biodevelopment of a complex tropical conserved wildland.
  • International Barcode of Life: iBOL - create a searchable directory for life on earth. And to build it, 8 billion searchers.
  • We are talking about GPS for biodiversity. ------- Where is your specimen in taxonomic space?
  • parataxonomists: 38 secure careers in wildland biodiversity management
  • ~ Area of Philadelphia and suburbs 85 km (1,200 km2) 12 Life Zones 13 rearing barns 365 days/year ~ 3 parataxonomists do ~ 40,000 rearings/yr
  • building the caterpillar and barcode library
  • 13
  • stack of events 03-SRNP-8745 http://janzen.sas.upenn.edu 03-SRNP-8745 Codotractus imalena http://janzen.sas.upenn.edu Hesperiidae 03-SRNP-8745 Codotractus imalena http://janzen.sas.upenn.edu Estacion Cacao 03-SRNP-8745 Codotractus imalena http://janzen.sas.upenn.edu Sector Hesperiidae Cacao 03-SRNP-8745 Estacion Cacao Hesperiidae Codotractus Area de Conservacion imalena http://janzen.sas.upenn.edu 03-SRNP-8745 Sector Codotractus imalena Estacion Cacao Hesperiidae Guanacaste Cacao http://janzen.sas.upenn.edu 03-SRNP-8745 Area de Hesperiidae Conservacion Sector Cacao Costa Rica Estacion Cacao imalena Codotractus 03-SRNP-8745 Guanacastehttp://janzen.sas.upenn.edu Area de Hesperiidae Conservacion Sector Codotractus imalena N323150 E375650 Cacao Estacion Cacao CostaArea de Conservacion Rica 03-SRNP-8745 Guanacastehttp://janzen.sas.upenn.edu 03/21/2003 Sector Cacao Estacion Cacao Hesperiidae N323150Ricade Codotractus imalena E375650http://janzen.sas.upenn.edu CostaArea LonchocarpusGuanacaste 03-SRNP-8745 Conservacion Sector Cacao Estacion Cacao Hesperiidae 03/21/2003E375650http://janzen.sas.upenn.edu N323150Ricade Codotractus imalena CostaArea oliganthus (Fabaceae)Estacion Cacao Guanacaste 03-SRNP-8745 Conservacion Sector Cacao Codotractus imalena Lonchocarpus Rica Hesperiidae 03/21/2003E375650http://janzen.sas.upenn.edu N323150 Harry Ramirez CostaArea de Conservacion Guanacaste 03-SRNP-8745 Sector Codotractus imalena Estacion Cacao oliganthus (Fabaceae)Cacao Lonchocarpus Rica Hesperiidae 03/21/2003E375650http://janzen.sas.upenn.edu +70 more fields CostaArea de Conservacion N323150 Guanacaste 03-SRNP-8745 Sector HarryLonchocarpus Estacion Cacao imalena Ramirez Hesperiidae oliganthus (Fabaceae)Cacao 03/21/2003E375650http://janzen.sas.upenn.edu N323150Ricade Codotractus CostaArea Guanacaste 03-SRNP-8745 Conservacion Sector Codotractus +70 more fields (Fabaceae)Cacao HarryLonchocarpus Estacion Cacao imalena Ramirez Hesperiidae oliganthus 03/21/2003E375650http://janzen.sas.upenn.edu N323150Ricade Conservacion CostaArea Guanacaste 03-SRNP-8745 Sector +70 more fields (Fabaceae)Cacao HarryLonchocarpus Estacion Cacao imalena Ramirez Hesperiidae oliganthus 03/21/2003E375650http://janzen.sas.upenn.edu N323150Rica Codotractus Costa Sector Guanacaste 03-SRNP-8745 Conservacion +70 more fields (Fabaceae)Cacao HarryLonchocarpus de Hesperiidae Ramirez Area Estacion Cacao imalena oliganthus 03/21/2003E375650http://janzen.sas.upenn.edu N323150Ricade Codotractus CostaArea Guanacaste 03-SRNP-8762 Conservacion Sector +70 more fields (Fabaceae)Cacao HarryLonchocarpus Estacion Cacao imalena Ramirez Hesperiidae oliganthus 03/21/2003E375650http://janzen.sas.upenn.edu N323150Ricade Codotractus CostaArea Guanacaste Conservacion Sector +70 more fields (Fabaceae)Cacao HarryLonchocarpus Estacion Cacao imalena Ramirez Hesperiidae oliganthus 03/21/2003E375650 N323150Ricade Codotractus CostaArea Guanacaste Conservacion Sector +70 more fields (Fabaceae)Cacao HarryLonchocarpus Estacion Cacao Ramirez Hesperiidae oliganthus 03/21/2003E375650 N323150Ricade Conservacion CostaArea Guanacaste Sector +70 more fields (Fabaceae)Cacao HarryLonchocarpus Estacion Cacao Ramirez oliganthus 03/21/2003E375650 N323150Rica Costa Sector Guanacaste +70 more fields (Fabaceae)Cacao HarryLonchocarpus de Conservacion Ramirez Area oliganthus 03/21/2003E375650 N323150Rica Costa Guanacaste +70 more fields (Fabaceae) HarryLonchocarpus de Conservacion Ramirez Area oliganthus 03/21/2003E375650 N323150Rica Costa Guanacaste +70 more fields (Fabaceae) HarryLonchocarpus Ramirez oliganthus 03/21/2003E375650 N323150Rica Costa +70 more fields (Fabaceae) HarryLonchocarpus Ramirez oliganthus 03/21/2003E375650 N323150 +70 more fields (Fabaceae) HarryLonchocarpus Ramirez oliganthus 03/21/2003 +70 more fields (Fabaceae) HarryLonchocarpus Ramirez oliganthus +70 more fields (Fabaceae) Harry Ramirez oliganthus +70 more fields Harry Ramirez +70 more fields COI: atcgcctaatgctgga…. …millions
  • Truck fulls 32 years of ACG Nymphalidae to US National Museum of Natural History
  • 130,000+ 5-legged vouchers.
  • Names are Us
  • History footnote: March 2003, Professor Paul Hebert & government Canada. Thank you.
  • The Mitochondrial Genome D-Loop Small ribosomal RNA Large ribosomal RNA Cyt b ND1 ND6 ND5 L-strand COI COI ND2 H-strand ND4 COI ND4L ND3 COIII COII ATPase subunit 8 ATPase subunit 6
  • An actual fly DNA barcode – A 650-letter “word” ACTTTATATTTTATTTTTGGAGCTTGATCTAGAATAATTGGAACTT CTTTAAGAATATTAATTCGAATTGAATTAGGTCATCCAGGTTCCTT AATTGGAAATGACCAAATTTATAATGTAATTGTAACAGCTCATGC ATTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGA TTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCACCAGATATAG CTTTTCCTCGAATGAATAATATAAGTTTTTGACTTCTTCCTCCTGCT TTAATACTTTTATTAACAAGTAGAATAGTAGAAAGTGGAGCTGGA ACAGGATGAACAGTTTATCCTCCTTTATCATCTATTATTGCTCATG GAGGAGCATCTGTTGACTTAGCTATTTTTTCTCTTCATTTAGCAGG AATTTCTTCTATTTTAGGAGCTGTAAATTTTATTACAACTGTAATT AATATACGATCTATTGGTATTACCTTTGATCGAATACCTTTATTTG TTTGATCAGTTGCTATTACAGCCTTATTACTTTTATTATCTTTACCA GTTTTAGCTGGAGCAATTACAATATTATTAACNGATCGAAATTTA AATACATCATTTTTTG
  • We are talking about GPS for biodiversity. ------- Where is your specimen in taxonomic space?
  • Biodiversity Institute of Ontario I, robot $400,000
  • barcodes, export quality from Canada
  • How do I get them?
  • Bob Poole at Nearctica http://www.nearctica.com/Argyrosticta/Argyrosticta.htm
  • Opsiphanes bogotanus tamarindi zelotes cassini quiteria invirae
  • Opsiphanes bogotanus tamarindi zelotes cassini Janzen01 quiteria invirae
  • Opsiphanes bogotanus girls tamarindi cassini zelotes Janzen01 cassini boys cassini Janzen01 quiteria Janzen01 invirae
  • Opsiphanes fabricii Opsiphanes jacobsorum
  • Opsiphanes fabricii Opsiphanes jacobsorum
  • Opsiphanes quiteria Opsiphanes jacobsorum
  • Licania arborea 27 Hirtella racemosa 63 Chrysobalanaceae Inga spp. 85 Andira inermis 2 Zygia longifolia 36 Fabaceae Prepona laertes
  • Prepona laertes & demodice Amphonyx lucifer Udranomia kikkawai Eacles imperialis
  • Danaus gilippus 1863
  • Asturodes fimbriauralis eats Colubrina (Rhamnaceae) 8% different in DNA barcodes rain forest sympatric Asturodes new species eats Gouania (Rhamnaceae)
  • Anacrusis males Anacrusis females
  • Urbanus segnestami Urbanus bernikerni Urbanus ehakerni Once Urbanus belli, now three new species
  • U. belliDHJ01 U. belliDHJ02 U. belliDHJ03 Tropical submontane evergreen forest Evergreen seasonal lowland forest subtropical Rain – Cloud forest Coastal rainforest Lowland deciduous forest Semi deciduous –deciduous forest Lowland semi deciduous forest Mangrove forest Herbaceous marshes Marshes and reed beds of typha Open savanna grasses Wooded savannah Shrub vegetation with isolated clumps Alluvial tropical rainforest vegetation
  • 16,000+ records of parasitic flies (Tachinidae), 5% of all. 420 morphospecies of flies. 96% very specialized, but 16 generalists with names. Monty Wood, taxonomist. But, are they generalists? Barcode 16 species.
  • Tachinidae Alex Smith Univ. Guelph
  • Those 16 generalist species turned into 73 species. Of these, nine remain generalists.
  • Canada to Argentina Creagrura nigripes Cubus validus ICHNEUMONIDAE Hyposoter INB-42 Mexico to Costa Rica
  • Hesperiidae: Nascus broteas x Braconidae: Apanteles leucostigmus
  • Braconidae: Microgastrinae: Apanteles leucostigmus becomes Braconidae: Microgastrinae: 37 species 3 32 32 2 rr
  • 640 new species of Costa Rican campoplegine parasitic wasps, all INBio and donors 186 new species of ACG braconid microgastrine parasitic wasps, all current ACG staff 800 new species of ACG tachinid parasitic flies, all current and past ACG staff & donors
  • ACG June 2013 What we thought we know, we don’t know. Use the new orca pictures. If time, A second one of giraffes or elephants. Everyone of us thinks we know the name; none of 7 billion people do.
  • From 30,000 feet, a trap sample: 27 Auto cari & 1 Auto minivani
  • Ian Gauld (1947-2009) = superb ichneumonid taxonomist
  • routine identification
  • Enicospilus (Ichneumonidae)
  • before barcoding, 1 day of work to identify,40spp
  • after barcoding, 11 undescribed species
  • What’s the hurry?
  • if you can’t read the forest, it’s just firewood
  • if you can’t read the forest, it’s just biofuel
  • Wright Brothers’ airplane
  • 1978
  • 2013
  • Canadian National Collection
  • accumulated voucher specimens
  • Atacta brasiliensis
  • sort by barcode, by host caterpillar
  • DHJ01 DHJ02
  • Noctuidae hosts of Atacta brasiliensis Coenipeta bibitrix Mocis latipes
  • Ethmia stephenrumseyi Tithraustes lambertae Erbessa stroudi Phareas burnsi Porphyrogenes peterwegei Anacrusis terrimccarthyae Urbanus bernikerni Euglyphis jessiehillae Dunama jessiebarronae
  • 150 staff $6.5 m/year 2% of Costa Rica 165,000 ha
  • 2% Of 9,000+ species 3 cases with nearly identical barcodes Adelpha melanthe Adelpha phylaca
  • What we lack is a program called “Know thy park” conducted by the conserved wildland itself in collaboration with the national and international community.
  • We have extraordinarily poor knowledge and understanding of what it is we are conserving, what it does, where it lives, and how to find it when we want it -in the big disorderly green garden. And we ask starving and stressed society to pay the bill to conserve the garden?
  • Phareas burnsi 2013 Phareas coeleste 1852