Differentiating beta cells of zebrafish

1. Beta cells Progenitors and its
Differentiation in Zebrafish
By,
Dorisa Jenifer .W

2. A brief overview
• Diabetes is a disease of high blood sugar. In India, more than 62 million
individuals are currently diagnosed with diabetes. In 2013 it was estimated that
over 382 million people throughout the world had diabetes.
•Researchers demonstrate that 70 per cent of protein-coding human genes are
related to genes found in the zebrafish and that 84 per cent of genes known to be
associated with human disease have a zebrafish counterpart.
•Thus, studying zebrafish behaviour in response to a drug or compound can
give us a better understanding of what the drug effects might be on humans as
well

3. A Drug Discovery Model

7. Alternatives for Insulin Production
• Beta (β) cells are unique cells in the pancreas that produce, store
and release the hormone insulin located in the area of the pancreas known
as the Islets of Langerhans.
• The appropriate function of insulin-producing pancreatic beta-cells is
crucial for the regulation of glucose homeostasis, and its impairment leads
to diabetes mellitus, the most common metabolic disorder in man.
• Even though insulin is a life saver, it does not cure the disease. Insulin
injections themselves are not without risk. Improvements in the
treatment of diabetes will come from a better understanding of how
insulin is made in the pancreas and released into the bloodstream, and
how it promotes uptake of circulating glucose by tissues including
muscle and fat.

8. Organs of Zebrafish

11. • The pancreas serves two major functions
(i) production of digestive enzymes by exocrine cells
(ii) Regulation of blood sugar by endocrine cells
• The mature exocrine part of pancreas consist of acinar cells connected to the intestine
via a highly branched ductal tree.
• The endocrine part of pancreas is comprised of islets of Langerhans that are primarily
scattered through the central regions of the organ. Several cells comprise the islet:
1. β cells (50-80%) and tend to segregate the islet core,
2. Glucagon producing alpha cells are the next most common type.
3. δ cells that produce somatostatin,
4. PP cells that produce pancreatic polypeptides, and
5. ϵ cells that produce ghrelin
• The zebrafish main pancreas is located on the right side of the adult fish, attached to the
lateral aspect of the duodenum by the pancreatic duct. Typically, one large islet and 3–6
smaller islets occupy the main pancreas of the adult zebrafish. The tail of the pancreas is
embedded with single β-cells.

13. Pancreatic Transcription Factors
• Transcription factor is a protein molecule which specifically binds to DNA
sequences, and hence controls the rate of transcription of genetic data’s from DNA
to messenger RNA.
• During pancreatic developmental stage, transcription factors require certain
sequential regulated expression to produce regular organogenesis.
• Some specific transcription factors are activated during pancreatic development at
early stage and β-cell differentiation, which may be switched off as the β-cell
matures slowly. Some transcription factors like, Pdx-1, Pax 4, Ptf1a are involved in
both early β-cell differentiation and mature β-cell function.
• In this research, the focus is on Transcription factors Pdx1, and Ptf1a.

15. Cell fate choices

18. β-cells expressing Pdx1

19. Pancreatic lineages

20. Mechanism of Insulin Secretion

21. Routes of β cells

23. Strategies to generate new β-cells

24. β cells in 18 somite stage

25. CONDITION NUMBER OF BETA CELLS ( 7 dpf)
Ganciclovir (GCV) treated 40±1
Untreated 30±2
RATE OF BETA CELL REPLIATION:
While performing beta cell nuclei counting through confocal analysis, E. Moro et all
has found out a linear growth in number of beta cell nuclei, with an average of 15%
per day in larval stages of zebrafish. (2009)

26. Collectrin/ TMEM27
• In the pancreas, TMEM27 is produced in beta cells specifically.
• Studies has shown a potential positive role of TMEM27 in glucose-stimulated
insulin exocytosis, another study linked TMEM27 production to beta cell
proliferation.
• The latter study also hypothesised that TMEM27, which is cleaved and shed into
the extracellular space, might be used as a beta cell mass biomarker.
• It plays the role of controlling insulin exocytosis by regulating formation
of the SNARE (soluble N-ethylmaleimide-sensitive-factor attachment protein
receptor) complex in pancreatic beta cells.
• Streptozotocin (STZ), a nitrosourea causes DNA damage after entering β-cells
through the Glut2 receptor. This is used to induce diabetes and can be used as a
control.

27. Developmental Stages

28. Ensembl data of Pdx1

29. Genome sequence of Pdx1
•ACGCTCAGACTGCAGGTAGAGCAGAGGTCCTGATCAGGGGCAGGG
CGCTGGCTCATGTGCTCGTGTACGGCACGGTTTCCCCGGTCTATGG
CAATCATGAATCGGGAAGAGCATTACTATCCGCCTAACCACCTGTAC
AAGGACTCTTGTGCCTTCCAGAGACACCCCAACGAAGACTACAGCC
AAAACCCTCCACCGTGTCTTTATATGAGACAGGCACATTCAGTATAC
GCCTCACCATTGGGCGCACAGGACCAGCCAAATCTTACCGACATTAC
TTCTTATAACATGTCGAGCCGGTATGATCTGGCAGGGCCTCATCTTC
ACCTTCCCCAAACTTCACAGACATCTCTACAGTCGCTCGGGGGTTAC
GGAGACTCTCTGGACCTCTGCGGGGATCGGAACAGATACCATCTCC
CATTTCCGTGGATGAAGTCAACCAAATCTCACACGCACGCATGGAAA
GGACAGTGGACAG
•These are the exon sequences of pdx1 gene obtained from ensembl.

30. Imaging β cells