• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Bioc4010 sample questions
 

Bioc4010 sample questions

on

  • 216 views

Some possible sample exam questions based on Lectures 1 and 2 on Human Disease Genomics.

Some possible sample exam questions based on Lectures 1 and 2 on Human Disease Genomics.

Statistics

Views

Total Views
216
Views on SlideShare
216
Embed Views
0

Actions

Likes
0
Downloads
5
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft Word

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Bioc4010 sample questions Bioc4010 sample questions Document Transcript

    • Bioc4010 Sample Questions:1. A) What is the base call accuracy of a base in an Illumina sequenced shortread with a Q value of 20?B) Is this better or worse than a Q value of 10?Answer: A) Probability 1 in 100 or 99% call accuracyB)Better. Q10 corresponds to a probability of 1 in 10 or 90% call accuracyFormula: Q = -10 log10 P2. What two primary advantages does exome sequencing provide over wholegenome sequencing?Answer: Cost and data reduction. Exome capture limits the sequencing to knownprotein-coding genes and some miRNAs.3. Split and sort the string ‘CAPTAINKIRK’ into its appropriate suffix arrayAnswer:AinkirkAptainkirkCaptainkirkInkirkIrkKKirkNkirkPtainkirkRkTainkirk
    • 4. Given a base-quality score threshold of Q30, the following short readalignment, and reference sequence, what is the genotype (two alleles, egG/C)at the indicated position? Base qualities for the position are listed on theside for each of the reads.AGCTCCCAGGGTCCAG Q29 GTCCAGTCTCGGTT Q40 CAGGGTCCAGTC Q47 TCCAGTCTCGGTTCCATC Q35 CCCAGGGCCCAG Q50 GGGTCCAGTCTC Q31 TCCCAGGGCC Q10 AGGGTCCAGT Q45 GCTCCCAGGGCCCAGTCT Q46CTCCCAGGGCCC Q33CCAGGGTCCAGTCQ38 GCTCCCAGGGCCCAGTCTCGG Q41 CAGGGTCCAGTCTCG Q15AGCTCCCAGGGTCCAGTCTCGGTTCCATCTA *Answer: Discard the reads where the base quality score is below Q30. Sum up thereference and alternate bases at the position. (T =6 , C = 4). Therefore the genotypecalled is T/C (heterozygous).5. Sort the following types of genetic variants into the categories: PotentiallyDisease Causing, Unlikely to be Disease Causing1. Splice Site2. Non-Synonymous3. Synonymous4. FrameshiftIndel5. Stop Loss6. Stop Gain7. Intronic (Non-Splice Site)8. IntergenicAnswer:Disease: 1, 2, 4, 5, 6Non-Disease: 3, 7, 8
    • 6) What is the primary motivation for using “next gen” sequencing methodsand modern genomics approaches to diagnosing human genetic diseases?Answer: Cost7) What does the base quality of a sequencing read tell you?Answer: The base quality is equivalent to the probability of an incorrect base call.(Also acceptable answer is the base call accuracy)8) What problem does binary search address?Answer: Efficiently searching the index of a genome