Bioc4010 Sample Questions:1. A) What is the base call accuracy of a base in an Illumina sequenced shortread with a Q value...
4. Given a base-quality score threshold of Q30, the following short readalignment, and reference sequence, what is the gen...
6) What is the primary motivation for using “next gen” sequencing methodsand modern genomics approaches to diagnosing huma...
Upcoming SlideShare
Loading in …5

Bioc4010 sample questions


Published on

Some possible sample exam questions based on Lectures 1 and 2 on Human Disease Genomics.

Published in: Education
  • Be the first to comment

  • Be the first to like this

No Downloads
Total views
On SlideShare
From Embeds
Number of Embeds
Embeds 0
No embeds

No notes for slide

Bioc4010 sample questions

  1. 1. Bioc4010 Sample Questions:1. A) What is the base call accuracy of a base in an Illumina sequenced shortread with a Q value of 20?B) Is this better or worse than a Q value of 10?Answer: A) Probability 1 in 100 or 99% call accuracyB)Better. Q10 corresponds to a probability of 1 in 10 or 90% call accuracyFormula: Q = -10 log10 P2. What two primary advantages does exome sequencing provide over wholegenome sequencing?Answer: Cost and data reduction. Exome capture limits the sequencing to knownprotein-coding genes and some miRNAs.3. Split and sort the string ‘CAPTAINKIRK’ into its appropriate suffix arrayAnswer:AinkirkAptainkirkCaptainkirkInkirkIrkKKirkNkirkPtainkirkRkTainkirk
  2. 2. 4. Given a base-quality score threshold of Q30, the following short readalignment, and reference sequence, what is the genotype (two alleles, egG/C)at the indicated position? Base qualities for the position are listed on theside for each of the reads.AGCTCCCAGGGTCCAG Q29 GTCCAGTCTCGGTT Q40 CAGGGTCCAGTC Q47 TCCAGTCTCGGTTCCATC Q35 CCCAGGGCCCAG Q50 GGGTCCAGTCTC Q31 TCCCAGGGCC Q10 AGGGTCCAGT Q45 GCTCCCAGGGCCCAGTCT Q46CTCCCAGGGCCC Q33CCAGGGTCCAGTCQ38 GCTCCCAGGGCCCAGTCTCGG Q41 CAGGGTCCAGTCTCG Q15AGCTCCCAGGGTCCAGTCTCGGTTCCATCTA *Answer: Discard the reads where the base quality score is below Q30. Sum up thereference and alternate bases at the position. (T =6 , C = 4). Therefore the genotypecalled is T/C (heterozygous).5. Sort the following types of genetic variants into the categories: PotentiallyDisease Causing, Unlikely to be Disease Causing1. Splice Site2. Non-Synonymous3. Synonymous4. FrameshiftIndel5. Stop Loss6. Stop Gain7. Intronic (Non-Splice Site)8. IntergenicAnswer:Disease: 1, 2, 4, 5, 6Non-Disease: 3, 7, 8
  3. 3. 6) What is the primary motivation for using “next gen” sequencing methodsand modern genomics approaches to diagnosing human genetic diseases?Answer: Cost7) What does the base quality of a sequencing read tell you?Answer: The base quality is equivalent to the probability of an incorrect base call.(Also acceptable answer is the base call accuracy)8) What problem does binary search address?Answer: Efficiently searching the index of a genome
