• Save
NGS in Forensics Genetics – examples using the GS Junior. Sponsored by Roche Diagnostics, Department of Forensic Medicine, University of Copenhagen, SUND, Martin Mikkelsen Copenhagenomics 2012
Upcoming SlideShare
Loading in...5
×
 

NGS in Forensics Genetics – examples using the GS Junior. Sponsored by Roche Diagnostics, Department of Forensic Medicine, University of Copenhagen, SUND, Martin Mikkelsen Copenhagenomics 2012

on

  • 1,739 views

Martin presented a talk about NGS in Forensics Genetics and discussed examples using the GS Junior. Sponsored talk by Roche.

Martin presented a talk about NGS in Forensics Genetics and discussed examples using the GS Junior. Sponsored talk by Roche.

Statistics

Views

Total Views
1,739
Views on SlideShare
1,578
Embed Views
161

Actions

Likes
1
Downloads
0
Comments
0

1 Embed 161

http://cphx.org 161

Accessibility

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

NGS in Forensics Genetics – examples using the GS Junior. Sponsored by Roche Diagnostics, Department of Forensic Medicine, University of Copenhagen, SUND, Martin Mikkelsen Copenhagenomics 2012 NGS in Forensics Genetics – examples using the GS Junior. Sponsored by Roche Diagnostics, Department of Forensic Medicine, University of Copenhagen, SUND, Martin Mikkelsen Copenhagenomics 2012 Presentation Transcript

  • NGS in Forensics Genetics – Examples using theGS JuniorMartin MikkelsenSection of Forensic Genetics, Department of Forensic Medicine, Faculty of Health and Medical Sciences, University of Copenhagen
  • Current methods used in Forensic Genetics SNPs/DIPs X-chromosomeY-chromosomes mtDNA Autosomal STR typing
  • Agenda Examples using the GS Junior in Forensic Genetics  STR sequencing  mtDNA sequencing Future aspects of NGS in Forensic Genetics GS Junior at Department of Forensic Medicine, Copenhagen
  • STR sequencing
  • STR-systems An accordion-like DNA sequence that occurs between genes TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGAAGACA GGTGGATAGATAGATAGATAGATAGATAGATAGATAGAT AGATAGATAGATATCATTGAAAGACAAAACAGAGATGGATGA TAGATACATGCTTACAGATGCACAC= 12 GATA repeats (“12” is all that is reported) 7 repeats Homozygote = both 8 repeats alleles are of the same 9 repeats length 10 repeats Heterozygote = alleles 11 repeats 12 repeats differ and can be resolved from one another 13 repeats Target region (Short Tandem Repeat)
  • Variation in STRs Detectable with CE  Not-detectable with CE based methods: based methods:  Variation in the number  Base substitutions of repeat units  Inversions of two or  Insertion and deletion more nucleotides of one or more  Mutation in the primer nucleotides in the binding site amplified region
  • STR typing by sequencing using NGSProof-of-concept:The long read length allows for sequencing of the whole STR region including flanking regionsClonal amplification allows for separation of the alleles and haplotyping
  • Examples using the GS Junior to sequence STRs  DS21S11  Included in most STR typing kits  A complex STR-system  3 repeat regions[TCTA]X[TCTG]X[TCTA]3TA[TCTA]3TCA[TCTA]2TCCATA[TCTA]X A B C
  • Case with three alleles Child 28;30;32.2 Mother30;32.2 28;30 30;32.2 Father 28;30;32.2 28;30 A B C
  • “Hidden” heterozygosis A B C
  • Deletion outside the repeat region Observed in two Somali samples A B C
  • mtDNA sequencing
  • mtDNA in Forensic Genetics? Cases with little or no autosomal DNA Complicated kinship cases where the maternal inheritance needs to be investigated Current mtDNA investigations:  Sanger sequencing of HV1 and HV2, or control region  Typing of selected SNPs in the coding region Advantages of full mtDNA sequencing:  15x more information than the control region  Increasing power of discrimination MtDNA contains heteroplasmy
  • Sequencing mtDNA at Section of Forensic Genetics• Sequencing of the whole mtDNA using the GS Junior• 20 samples in one run• High coverage (estimated coverage ~ 100x)• Must be able to detect and quantify heteroplasmy
  • mtDNA sequencing runCardiac 4RUN data: Reads: 137091 Bases: 58760702 averageLength: 428,626 averageQuality: 30,251 Mapped Avg. Map No. reads %-mapped Contig Avg. Depth reads Length:Sample 1 3231 3173 98% 1 76,8 400Sample 2 4428 4362 99% 1 107,8 408Sample 3 6114 6028 99% 1 151,2 414Sample 4 8561 8433 99% 1 215,1 422Sample 5 6087 5985 98% 1 150,1 415Sample 6 5572 5475 98% 1 137,5 415Sample 7 6376 6268 98% 1 156,7 413Sample 8 4445 4359 98% 1 108,4 411Sample 9 7040 6922 98% 1 173,8 415Sample 10 4239 4175 98% 1 105,2 416Sample 11 5379 5307 99% 1 134,8 420Sample 12 6775 6673 98% 1 166,8 413Sample 13 6574 6481 99% 1 165,8 423Sample 14 4186 4105 98% 1 103,1 415Sample 15 6110 6002 98% 1 153,7 423Sample 16 10852 10698 99% 1 273,9 423Sample 17 9205 9066 98% 1 233,5 426Sample 18 11663 11472 98% 1 297,5 429Sample 19 10996 10815 98% 1 278,3 425Sample 20 8827 8680 98% 1 218,2 415 Avg. 170,41
  • HeteroplasmyPoint heteroplasmy at pos. 195
  • What does NGS give to forensic genetics?A higher throughput!STRs: A system that is fully compatible with current used technology Database Profiles in database CODIS (USA) 9,404,747 NDDNA (UK) 5,512,776 March 2011 Additional information from STR systems increasing the power of discriminationmtDNA: Easy sequencing of the entire mtDNA Detection and quantification of heteroplasmy
  • Future aspects of NGS in forensics
  • Future aspects of NGS in forensicsMolecular autopsyCardiac gene sequencing project 585 regions from 33 cardiac genes Involved in electrical conduction in the heart Captured using NimbleGen SeqCap EZ Library Can be sequenced on the GS Junior with one runWill provide additional information to pathologist performing the autopsy
  • Future aspects of NGS in forensicsPatient suffering from Brugada syndromeCarrying a mutation in the SCN5A gene (R121W)
  • Future aspects of NGS in forensics Forensic Toxicology Forensic NGS Genetics Forensic Pathology The ultimate forensic autopsy report
  • AcknowledgementsSection of Forensic Genetics:Marlene AndersenStine Hansen And…Eszter RockenbauerAnders J. HansenRune Frank-HansenClaus BørstingMichael StangegaardNiels MorlingAnja JørgensenNadia JochumsenMaibritt Sigvardt