Your SlideShare is downloading. ×
0
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms (SNPs)

899

Published on

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
899
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
0
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Experimental validation, integration to the linkage map and gene flow pilot study in common bean using Single Nucleotide Polymorphisms e (SN ) NPs) NP Constanz Quintero za MSc. Pl t Genetic R MS Plant Ge ti Resources Universidad Nac cional de Colombia
  • 2. Con ntents Introduction Objectives Subjects 1. Experimental valid dation of SNPs 2. Genetic map saturation 3. Gene flow pilot study p y Conclusions
  • 3. Introduction (cont… SNP AGGCGGCGTAGCTTTGCAGTACA AGGCGGCGTAG GCTTTGCAGTACA AGGCGGCGTAGCTTTGTAGTACA AGGCGGCGTAG GCTTTGTAGTACA SNP discovery in Phaseolus vulgaris L. Glycine max L. Merrill. CIAT-Gaitán-Solís et.al. 2008. Soybean Genomics Lab-USDA Perry Cregan, y g , Direct sequencing of coding and non- - coding regions (300-1000bp) Resequencing soybean unigenes in 10 genotypes Leguminosae species. 223 SNPs found in 20964pb 174 SNPs primer trios trios. 25 primer trios
  • 4. Objectives General: To assess the potential of SNP markers for diversity, gene flow and phenotype-genotype association studies in P. vulgaris. Specific: To validate available SNP markers identified in common bean and s soybean. To integrate validated SNPs to th existing linkage map (DOR364/ he G19883). G19883) To study the relationship between s some phenotypic characteristics and individual SNP alleles or haplotypes. To characterize the genetic diversity of a wild-weedy-crop complex from y Colombian and determine whether S SNPs could provide evidence of gene dynamics i P vulgaris. flow d fl i in P. l i
  • 5. 1. SNP Validation Plant material: GNumber or ID Biological status s Origin Genepool DOR364 Cultivated-Bred Lin ne M G19833 Cultivated-Landrac ce Perú A G23421 Wild Perú A G5773 Cultivated-Bred Lin ne M G4494 Cultivated-Bred Lin ne A G2771 Wild México M G4342 Cultivated-Landrac ce México M G16110 Cultivated Perú A G23432 Wild México M G23422 Wild Perú A 130 soybean-derived SNP mar y rkers
  • 6. SNP GENOTYPING: Single Base Extension (SBE) in flow cytometer Luminex100 Two to three fragments DNA template amplified per reaction PCR mutiplex PCR number decreased in 30%, due to multiplex 130 SNP-containing fragments adjustment dj t t Pool of PCR-multiplex, same SNP type Up to 15 SNP loci screened in one SBE reaction d A Allele A Mean Fluorescenc Intensity A A A A 2,000 A A 1,500 A A A 1,000 A 500 92 SNPs ce SBE multiplex 0 464 938 526 691 976 709 791 79 93 799 858 893 497 523 527 G 578 validated as true 1,200 Allele G G polymorphisms 1,000 800 G 600 G n 400 200 0 464 938 526 691 976 709 791 793 3 799 858 893 497 523 527 578 SN NP
  • 7. 2. Integration of SN to the linkage map NPs 2 0cM B ng0 4 5 G 1 0 01 D GC10 E 0 71 G F 08 2 G M9DB1D B ng0 8 3 S NP 3 4 1 B ng 0 2 3 S NP 7 9 1 L 04 5 G B ng0 9 1 S NP 9 3 8 S NP 1 7 4 S NP 6 0 7 A A1 9 8 G L 04 86 G S NP 9 3 3 , S NP 5 1 0 S NP 1 9 C A S NP 2 6 T C P S NP 8 0 5 S NP 1 8 9 B ng1 6 1 S NP 5 C A S NP 2 8 A G S NP 6 6 2 B ng 0 7 1 b M130D S NP 6 2 1 S NP 2 1 9 S NP 3 3 9 P S NP 2 6 5 S NP 4 5 5 B ng1 2 6 B ng0 3 2 S NP 1 7 TC A N0 3 4 D S NP 7 5 8 S NP 6 3 7 S NP 6 0 9 S NP 2 4 C T AK 0 6 3 6 G GC09 S NP 4 7 8 S NP 7 9 3 D A3 9 3 S NP 3 0 1 K 1 21 D V1 0 3 G S NP 9 0 2 K 1 22 G A A1 9 3 D A N0 3 3 D S NP 8 G C P E 0 73 D U0 1 1 D S NP 5 2 6 B ng 0 9 4 B ng0 5 2 S NP 2 8 2 S C AR 2 c D U1 0 0 2 D S NP 5 2 7 S NP 5 9 1 P K 1 23 D D A8 8 S NP 4 4 1 H2 0 3 D S NP 9 9 2 L 04 97 D S NP 3 4 5 V1 0 4 D G A2 6 P 1 60 1 D DC96a H1 9 1 G S NP 3 6 1 A0 1 6 D K 1 26 G P9DB1D Y 5 01 D S NP 2 7 G A B ng0 0 3 b B ng0 2 4 S NP 2 0 G T P1DB3G S NP 0 8 3 S NP 7 7 1 S NP 6 6 7 F 08 4 G H1 8 5 G O 2 0 105 G B ng1 0 8 S NP 2 9 8 S NP 4 6 2 Y 5 02 G S NP 9 5 7 S NP 8 3 1 G185D AS 8 .9 0 0 S NP 1 4 9 S NP 8 4 8 B ng0 2 5 B ng 0 2 7 B ng0 0 1 S NP 7 0 9 AG 1 3 0 1 D P1DB2D B ng0 0 5 B ng0 4 2 S NP 1 8 0 S NP 9 3 5 S NP 0 6 6 P B ng0 6 0 S C AR 1 a G S NP 2 6 7 H1 9 3 G A1 4 1 D V1 0 8 D S NP 7 3 7 S NP 5 7 4 S NP 6 2 6 S NP 8 5 8 S NP 7 3 0 AK 0 6 4 4 D S NP 5 8 8 S NP 5 9 3 A1 4 4 G S NP 2 7 6 B ng 0 4 6 S NP 1 6 2 S NP 0 3 8 M124D S NP 1 1 G T S NP 2 0 1 K 1 28 1 G G122G S NP 8 1 9 B ng2 0 4 D 1 80 1 D B ng0 4 9 S NP 8 4 7 P S NP 9 0 8 P S NP 2 3 TC S NP 8 5 6 AG 1 3 0 2 D O204G B ng0 7 1 S NP 8 5 0 P S NP 5 7 6 S NP 5 7 8 , S NP 7 8 5 S NP 3 3 7 , S NP 6 6 8 S NP 1 8 2 S NP 1 1 7 A A1 9 1 0 D B ng0 4 8 S NP 6 9 1 D A1 1 S NP 0 1 5 AK 0 6 1 D G A2 6 a S NP 5 8 3 B ng0 9 6 B ng1 2 9 S NP 5 0 9 D A6 2 S C AR 2 bD S W 1 2 .70 0 X 1 12 D S NP 0 8 4 Hin d4 3 4 D 0 54 G S NP 0 7 8 P H1 8 2 D S NP 1 5 9 O 2 0 112 D W 2 03 D H1 9 8 G S NP 3 0 5 , S NP 7 1 5 S NP 2 6 1 S NP 5 8 2 S NP 3 0 C T S NP 2 0 4 S NP 0 5 5 L 04 7 D S NP 7 1 6 AD 1 8 0 1 G S NP 5 0 1 , S NP 5 2 9 F 70 1 D A H1 7 4 G S NP 7 8 8 S NP 1 4 4 B ng1 6 0 S C AR 2 dD G A TS 1 1 GC07c B ng1 1 8 S NP 7 1 8 S NP 5 4 1 S NP 9 0 1 , S NP 5 0 0 S NP 0 9 1 , S NP 4 9 2 S NP 2 5 0 S NP 0 6 8 S NP 1 0 G T S NP 2 0 3 S NP 6 6 9 , S NP 4 9 4 S C AR 1 bD S NP 7 7 8 S NP 4 G C G A2 3 B ng1 1 7 S NP 8 2 2 B ng 0 8 0 c S NP 7 9 9 G A TS 5 4 B 0 4 -b S NP 8 0 8 B ng 0 8 0 D 1 83 1 B ng0 4 7 D A5 9 H1 8 1 D B 1 1 -j j S NP 6 8 9 H1 9 6 2 D G A TS 9 1 S NP 6 4 5 S NP 2 9 A T B ng 0 9 5 B ng0 2 6 B 0 9 -k M 1 1 017 C S NP 5 0 2 , S NP 5 2 1 S NP 2 9 G A B 0 8 -f DC87 P 1 01 D S NP 6 1 6 B ng0 7 5 B 0 5 -e S NP 0 4 5 S NP 8 2 4 AG 1 B 0 6 -g B 0 7 -a B 1 0 -i S NP 0 4 4 S NP 1 5 G T S NP 3 8 3 B ng0 1 1 B 0 1 -h S NP 5 1 2 S NP 9 8 4 S NP 6 9 9 S NP 9 7 4 O207G B ng0 1 2 B ng0 1 6 S NP 2 1 C T 135 added to the linkage map-Mapmaker d S NP 2 1 6 B 0 2 -d G A2 1 S NP 5 3 9 S NP 1 5 3 S NP 5 2 3 Final map with 470 markers. DC35 pr5 9 9 D Several LG regions covered by SNPs Gs B 0 3 -c SNP ord needed for haplotype inference der
  • 8. 3.Gene flow pilot study. C Wee W “G50879” C Colombia, C Dept. Caldas C MEX Wee C GTM C C CRI Wee Wee COL ECU Chloroplast haplotypes and SSR most p p yp frequent alleles were shared between wild and cultivated types PER BLV No clear discrimination between biological forms at the DNA level could be observed Wild-weedy-crop complexes No gene flow direction could be determined Source:URG-CIAT
  • 9. Cont.. Gene flow pilot study. 1. Genotyping: 2. SNP haplotype inference (HAP) 20 SNPs (LGs B01 y B07), 3 blocks/LG All polymorphic 2-12 haplotypes/block ( (Total=43). ) 3. Gene flow estimation - Admixture coe efficient (MY) (ADMIX1_0) ( ( ) SNP haplotype MW1 S.D.2 distribution within and 0.58 0.12 between biological forms Too high Parental Wild a Cultivated and MC3 S.D. S.D. values to be re- -defined 0.42 0.16 Blocks with PIC≥0.7: 1 y 2 in B01; 1M 1 in B07 W: relative contribution from the wild parental population 2S.D: Standard deviation based on 1000 resampling events. n 3M C: relative contribution from the c cultivated parental population
  • 10. SNP haplotypes frequency in the complex G50879 100 W ild W eedy Cultivated 80 C Block 1 B01 1, 60 PIC = 0.70 40 W W 20 W C W C 0 A B C D E F G H Frequency (%) 100 80 Block 2, B01 PIC = 0.76 60 C W 40 W C F 20 W C C W C C C 0 A B C D E F G H I J K L 100 80 Block 1, B07 C PIC = 0.73 60 W 40 20 W C W W C C 0 A B C D E F G H I J K Haplotype v variant
  • 11. Re-definition of genetic diversity structu inside the wild-weedy-crop complex ure G500879 Parental “Truly” Wild “Tr l ” Parental “Tr l ”c lti ated “Truly”cultivated Wild [Phenotype +haplotype] Cultivated [Phenotype +haplotype] Admixture events Wild SNP Haplotype Cultivated SNP Haplotype Hybrid H b id populations l ti Mixed haplotypes Wild-hybrid Weeedy Cultivated-hybrid Ms 0,4669 4458 0,4 0,3237 DS 0,055 0436 0,0 0,0501 Mc 0,5281 5518 0,5 0,6766 DS 0,0588 043 0,0 0,0495 Mc/Ms 1,1 1,2 2,1 Probable Geneflow No-preferential bi-directional No-prefferential bi-dire ectional From cultivated direction
  • 12. Conclusions A reproducible methodology fo simultaneous SNP genotyping p gy or g yp g could be adjusted using SBE met thod in a Luminex100 platform. Lessons learned on such multiplex SNP genotyping method were p g yp g useful to perform rapid mapping of validated SNPs, and were also g applied to other crops. Description of LGs was increas sed after the integration of SNPs markers to linkage map of DOR3 364/G19833.
  • 13. Conclusions No association was found bet tween SNPs and the response to isolates of ANT and ALS evalua ated in the mapping population. SNP haplotypes were inform mative enough to describe the structure of the genetic diversit of Colombian germplasm. ty SNP markers provided evidence of gene flow dynamics in the wild-weedy-crop complex G508 879, and allowed a more accurate estimation of admixture coeficie ents.
  • 14. Acknowledgments Ginés-Mera Fel llowship Fund FDRH- -CIAT Universidad Nacional de Col lombia - Rigoberto Hidalgo Soybean Genomics Lab USDA - Perry Cregan, Charles Quigley CIAT-BRU CIAT-UURG CIAT-BEAN PROGRAM Joe Tohme Rosa Goonzález Héctor F. Buendía Eliana Gaitán Daniel De ebouck Henry Terán Myriam C. Duque Orlando Toro o Carlos Jara Janneth Gutiérrez
  • 15. 2. Integration of SN to the linkage map NPs 8 87 RILs ( 9) ( eebe et a , 1998) s (F9) (B e al, 998) DOR 364 G19833 135 added to the linkage m (LOD ≥ 4)-Mapmaker map Final map with 470 markers. s. s
  • 16. Introduction: Ph haseolus vulgaris L. Wild P. vulgaris Diploid (2 22) Di l id (2n=22) Mainly autogamous y g Cultivated worldwide High nutritional value 45% produced in Latin America d d i L ti A
  • 17. SNP GENOTYPING: Single Base Extension (SBE) in flow cytometer Luminex100 n
  • 18. Results SNP validation P I. PCR validation II. SBE validation Single PCR in DOR364 (130 SNPs) 20 PCR products pooled=20SNPs Fragment size + optimal Temp determined PCR-multiplex groups defined SNP 01 SNP 11 SNP 01 a a a Reproducibility of PCR-multiplex SNP 10 SNP 20 SNP 20 DOR364 and G19833 confirmed Reproducibility tested Low vs high number pooled SBEs PCR number products decreased in 30%, due to multiplex Luminex: adjustment Mean Fluorescence Intensity Masterplex GT Threshold values defined, Allele calling performed 10 genotypes PCR 1 PCR 2 PCR 3 ... PCR n 92 SNPs validated as true polymorphisms Same SNP n SNPs n SNPs n SNPs n SNPs
  • 19. Simultaneous SNP genotyping in DOR364 P A sity Allele A A A A scence Intens 2,000 1,500 A 1,000 500 0 028 144 182 219 2 250 265 301 305 5CA C C Mean Fluores 2,000 Allele C C 1,500 1,000 C 500 0 028 144 182 219 2 250 265 301 305 5CA M SNP A Allele A cence Intensity A A A A A 2,000 2 000 A 1,500 A A A 1,000 A 500 0 464 938 526 691 976 709 791 793 799 858 893 497 523 527 578 Mean Fluoresc G 1,200 Allele G G 1,000 800 G 600 G M 400 200 0 464 938 526 691 976 709 791 793 799 858 893 497 523 527 578 SNP

×