Weiland Meyer - Algae, Protists & Fungi Plenary
Upcoming SlideShare
Loading in...5
×
 

Weiland Meyer - Algae, Protists & Fungi Plenary

on

  • 1,548 views

 

Statistics

Views

Total Views
1,548
Views on SlideShare
1,548
Embed Views
0

Actions

Likes
0
Downloads
13
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

CC Attribution-NonCommercial LicenseCC Attribution-NonCommercial License

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment
  • A huge amount of ITS sequences are available in the public database GenBank. But the inaccuracy of GenBank ITS is a known problem, with many sequences containing mistakes as a result of experimental errors, misidentification or exchange of cultures and a limited taxonomic coverage.

Weiland Meyer - Algae, Protists & Fungi Plenary Weiland Meyer - Algae, Protists & Fungi Plenary Presentation Transcript

  • An update on DNA barcoding of human pathogenic fungi Meyer, W 1 , Serena, C 1 , Firacative, C 1 , Kröger, B 1 , Arabatzis, M 2 , Robert, V 3 , de Hoog, S 3 , Balajee, A 4 , Velegrak, A 2 1 Molecular Mycology Research Laboratory, Sydney Medical School – Westmead, University of Sydney, Westmead Millennium Institute, Westmead Hospital, Westmead, NSW, Australia 2 Medical School, University of Athens, Athens, Greece 3 CBS-Fungal Biodiversity Center, 3508 AD Utrecht, The Netherlands 4 Mycotic Diseases Branch, Centers for Disease Control and Prevention, Atlanta, GA, USA E-mail: w.meyer@usyd.edu.au © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • Major Issues in Medical Mycology
    • Constant increase in invasive fungal infections
    • Insufficiency of the current identification techniques (morphology/physiology)
    • Limited available therapies
    • Emergence of resistant fungal strains
    © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 Urgent need to improve fungal identification to enable a substantial improvement in clinical diseases outcome! Blastomycoses Zygomycoses Candidiasis © D.Ellis © S. Chen © D.Marriott
  • Sequence based identification strategies are the new “gold standard” for species ID
    • However, there are major problems with sequence based ID:
    • Lack of a universally accepted appropriate genetic locus
    • (B) Lack of quality controlled sequence databases
    • (C) Arbitrary defined cut-off points for species ID
    Molecular diagnostic tools
    • Achieve rapid and accurate detection and identification
    • of fungi from cultures or clinical specimens
    © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • COX1 Alternative loci: ITS1/2 region D1/D2 LSU rDNA gene Histone spacer TUB ACT Elongation Factor AFTOL genes: RNA polymerase genes RPB1 RPB2 A DNA Barcode for fungi? © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 does not work for many fungi used since the 1990’s
  • LSU data show coinciding similarities among species! ACT1 data resolved all investigated species! LSU, COX1, RPB1 and RPB2, ACT1 © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • The International Sub-commission on Fungal Barcoding has proposed the ITS region as the prime fungal barcode or the default region for species identification ( http://www.allfungi.com/its-barcode.php ). Fungal specific primers: SR6R: 5’ AAGTATAAGTCGTAACAAGG 3’ LR1: 5’ GGTTGGTTTCTTTCCT 3’ [Vilgalys & Hesters (1990) J. of Bacteriol. 20: 4238-4246] © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • Steps towards a Fungal DNA barcode - All Fungi Barcode of Life Planning Workshop Smithsonian Conservation and Research Center, Front Royal, Virginia 13-15 May 2007
    • Fungal DNA barcoding meeting Amsterdam April 2011
    • Large multi-centre and multi national study [ ITS, LSU, SSU, RPB1 {RPB2, MCM7}]
    • (Conrad Schoch, Keith Seifert, John Spouge, Vincent Robert, Elena Bolchacova & more than 130 global colaborators )
    © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 Pezizomycotina Basidiomycota Saccharomycotina Basal All John Spounge, NCBI
  • Outcomes
    • RPB1 consistently produced the best results, followed
    • by ITS
    • Multigene combinations had slight improvements
    • Ease of amplification makes the ITS the current best
    • compromise choice for a fungal DNA barcode
    © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 Schoch et al. The internal transcribed spacer as a universal DNA barcode marker for fungi. Submitted to PNAS October 2011
  • 3573 5667 1 23 10 13.1.2009 3863 Fungal Barcodes 4.8.2010 6047 Fungal Barcodes 13.4.2011 7813 Fungal Barcodes 29.11.2011 9274 Fungal Barcodes © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • If medical fungi are blasted: e.g. Candida albicans no results !!!!!! www.boldsystems.org ITS1/2 region © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • ~172,000 full-length fungal ITS sequences are available in Genbank PROBLEMS Public databases: GenBank = EMBL = DDJB © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
    • many sequences containing mistakes:
    • limited taxonomic coverage.
    • the total number of currently available fungal ITS sequences,
    • represents less than 1% of the estimated 1.5 million fungal
    • species
    • as a result of experimental errors
    • misidentification of the species
    • exchange of cultures
  • Comparative sequence based identification is only meaningful if:
    • well-curated, robust and reliable databases are available
    • that are populated with sequence data from:
    • the strains have been rigorously validated in terms of
    • their nomenclature
    • type or reference strains (where possible)
    • a wide range of clinical strains
    • a wide variety of target species
    © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • New Quality controlled ITS sequence database at the Molecular Mycology Research Laboratory at: http://www.mycologylab.org/BioloMICSID.aspx 1 2 3 4 5 6 7 8 © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
    • ITS database of Medical Fungi at: http://www.mycologylab.org 476 strains representing 182 human pathogenic fungal species (of 200 species which cause commonly human/animal diseases from the 1.5 Mill fungal species estimated to exist)
    • Quality controlled in-house ITS data offer a higher accuracy and better predictive value for the correct identification of clinically important fungi than GenBank
    • Other well-curated ITS database e.g. are:
    Quality Controlled Database © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 Need to be integrated into BOLD
    • Established: January 2010
    •  
    • Founding Coordinators: A/Prof. Wieland Meyer (University of Sydney, Australia)
    • Prof. Sybren de Hoog (CBS-KNAW, The Netherlands)
    • Dr. Arun Balajee (CDC, USA)
    •  
    • Current Coordinators: A/Prof. Wieland Meyer (e-mail: w.meyer@usyd.edu.au)
    • P rof. Sybren de Hoog (e-mail: s.hoog@cbs.knaw.nl)
    • Objectives: (1) to establish a medical barcode database as part of BOLD by incorporating the different already existing fungal group specific databases,
    • (2) to extend the number of quality controlled ITS sequences to cover all medical
    • important fungi over the next 3 years,
    • (3) to incorporate this sequences into BOLD, and
    • (4) to achieve a special status as quality controlled reference sequences for those
    • sequences within Genbank.
    • Membership: The working group is open to everybody who is interested on molecular identification of pathogenic fungi.
    © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • Major outcomes of the first meeting of the working group: TIMM5 2-5.10.2011 Valencia, Spain University of Aix Marseille University of Sydney CBS Institute Pasteur Paris Others Joined ITS Database for Human/Animal Pathogenic Fungi BOLD Genbank Incorporating Sequence & MALDI-TOF MS data Next Meeting at 18 Th ISHAM Congress 11-15.6.2012 in Berlin German © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • Sequence based ID currently based on a cut-off point of 98-99% similarity with the type culture of the species in question. However, population based studies showed that the sequences variation in clinical samples is much higher as those type culture dependent cut-off values. © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • Molecular species borders currently undefined! Currently type culture based cut off point: 99% Carolina Serena/Wieland Meyer Type Culture Based Cut-Off Point: 98-99% Clinical sample based cut-off value: 91.5% similarity © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • ITS works well ITS not variable enough ITS variable within species Sybren de Hoog © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 Raises the question: Is the ITS region the best barcode for fungi?
    • 21 complete fungal genomes
    • 1 complete plant genome
    • 3 complete animal genomes
    • 531 eu K aryote O rthologous G roups (KOGs) of proteins
    • 531 single gene trees
    • 1 super gene tree
    © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 Should we continue with the genes that we are currently using?
  • Should we continue with the genes that we are currently using ? Robert et al. 2011 © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 For fungal ID most likely a combination of genes is needed
    • DNA barcoding of pathogenic fungi as the basis for the development of novel standardized diagnostic tools
    • CI’s: Wieland Meyer (University of Sydney, Australia)
    • Vincent Robert (CBS/BioAware, The Netherlands/Belgium)
    • David Ellis (SA Pathology, Australia)
    • Sharon Chen (Westmead Hospital, Australia)
    •  
    • AI’s: Conrad Schoch (GenBank, USA)
    • Arun Balajee (CDC, USA)
    • Aristea Velegraki (University of Athens, Greece)
    • Sybren de Hoog (CBS, The Netherlands)
    • Atlas of Living Australia (Canberra, Australia)
    APP1031952 New Project: 2012-2014 © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • Aims
    • Aim 1. Identification of the most informative genetic locus/loci to be used for DNA barcoding of pathogenic fungi, by applying comparative genomics to all currently publically available fungal genomes
    • Aim 2. Identification, design and testing of potential primers for the amplification of these loci from a wide range of pathogenic fungi
    • Aim 3. Generation of DNA barcodes and integration into reference databases for automated molecular identification of fungi accessible via the world-wide-web
    • Aim 4. Application of the novel identification system in the clinical setting
    The identified locus/loci will form the basis for the development of new barcode identification tools, which will revolutionize the identification of fungal pathogens in the clinical or quarantine setting. © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011 2 position available: 1) Postdoc with experience in Bioinformatics/whole genome analysis 2) RA with experience in microbiology/mycology/molecular biology
  • Project Impact: © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
    • Loop-mediated isothermal amplification (LAMP)
    • Rolling circle amplification (RCA)
    • Reverse line blot (RLP)
    • Quantitative real-time PCR (qPCR)
    • Specifically primed PCR
    • Probing with microarrays
    • MALDI-TOF
    DNA Barcoding - Basis for the Development of New Molecular Identification Methods: © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • Application of DNA barcoding Longitudinal studies of Airway Colonization in Cystic Fibrosis patients and influence on disease progression microbiome studies via next-generation sequencing of sequential sputum samples © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011
  • Acknowledgements Molecular Mycology Research Laboratory, University of Sydney, Sydney Medical School – Westmead Hospital Carolina Firacative, Benjamin Kröger, Carolina Serena, Heide-Marie Daniel, Krystyna Maszewska, Matthew Huynh, Clement Kin Ming Tsui, Nathalie van de Wiele, Sharon Chen, Wieland Meyer Centre for Infectious Disease and Microbiology, Westmead Hospital Fanrong Kong, Ying Sun, Catriona Halliday, Xianyu Zeng, Guy Porter, Ok-Cha Lee, Tania Sorrell CBS-Fungal Biodiversity Center, Utrecht, The Netherlands BioAware, Hannut, Belgium Vincent Robert Mycology Reference Laboratory, Department of Microbiology, Medical School, University of Athens, Athens, Greece Aristea Velegraki, Michael Arabatzis NIH, NCBI, Genbank, Bethesda MD, USA Conrad Schoch, John Spouge LifeTech , USA Elena Bolchacova # 352303 to WM APP1031952 Funding: EC- FP7-228310; Sloan Foundation to VR © WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011