Your SlideShare is downloading. ×
Kopniczky Margarita
Mit építsünk az élet anyagából?
A Biológia mint Technológia
Acropora millepora
Rekombináns DNS
A Génművesség alaptechnológiája
amilCP gén DNS plazmidon
Rekombináns baktérium telepek
DNS szekvenálás es szintézis ára
Biológiai rendszerek építése és átalakítása, mérnöki megközelítéssel.
Szintetikus Biológia
David S. Goodsell
Mérnöki megközelítés
Szabványosított biológiai építőelemek leltára
• 2003,Tom Knight, MIT
• Biobrick Public Agreement
• 2 000 kiosztott minta 2...
International Genetically Engineered Machine Competition
Lehet-e Szintetikus Biológiával a
szemetet átalakítani…
… ezekké?
• Bakteriális energia-tár
• Petrokémiai műanyag alternatíva
• Biokompatibilis
• Növényi anyagokból
• Drága
• Az SRF (visszanyert tüzelőanyag) az újra-hasznosító üzemek
24 000 Ft-ba kerul
az SRF elszallita...
Miből van az SRF?
Simon Little,
Marketing Manager
1: Bioműanyag Szemétből
2: Bioműanyag Újrahasznosítás
2. Rész1. Rész
A project lényege
Mérnöki folyamat
eredeti operon
BBa_K934001 (Tokyo iGEM 2012),
Control phaCAB
Nilus-voros festes - PHB
A PHB termeles PhaB-re erzekeny
of [PHB]
Time (minutes)
A PHB termeles PhaB-re erzekeny
Novekvo PhaB szint hatasa a PHB termelesre
BBa_K934001 + BBa_K608002 = BBa_K1149051
régi új
Mérnöki folyamat
1: Bioműanyag Szemétből
2: Bioműanyag Újrahasznosítás
2. Resz1. Resz
A project lenyege
PHB előállítása szemétből
A baktériumokból
kivont PHB
Egy 3-HB orvosi assay kit sárga
színreakcióval jelzi a PHB jelen...
Mérnöki folyamat
M.A.P.L.E. kuka
BpSM 2014.04. - Kopniczky Margarita: Mit építsünk az élet anyagából?
BpSM 2014.04. - Kopniczky Margarita: Mit építsünk az élet anyagából?
Upcoming SlideShare
Loading in...5

BpSM 2014.04. - Kopniczky Margarita: Mit építsünk az élet anyagából?


Published on

Mit építsünk az élet anyagából?

Kopniczky Margarita - Centre for Synthetic Biology and Innovation, Imperial College London

A biológiai folyamatok technológiai felhasználása egyidős az emberiséggel. Ma az élet “programozási nyelve” kezd elénk tárulni DNS kód formájában, és megértésével lehetőség adódik arra is, hogy magunk tervezzünk és építsünk sejteket. A Szintetikus Biológia célja komplex génrendszerek racionális tervezése, mérnöki megközelítéssel. A klasszikus géntechnológiából kinőtt új tudománytetület potenciálját és lendületességet jól illusztráló iGEM versenyen egyetemista csapatok teszik fel évről évre a kérdést: Mit építsünk az élet anyagából? Az Imperial College Plasticity projektjenek eredményeiről tartok beszámolót.

Budapest Science Meetup, 2014.04.10.

Published in: Education
  • Be the first to comment

  • Be the first to like this

No Downloads
Total Views
On Slideshare
From Embeds
Number of Embeds
Embeds 0
No embeds

No notes for slide

Transcript of "BpSM 2014.04. - Kopniczky Margarita: Mit építsünk az élet anyagából?"

  1. 1. Kopniczky Margarita Mit építsünk az élet anyagából?
  2. 2. A Biológia mint Technológia
  3. 3. Acropora millepora Rekombináns DNS A Génművesség alaptechnológiája amilCP gén DNS plazmidon Rekombináns baktérium telepek
  4. 4. DNS szekvenálás es szintézis ára
  5. 5. Biológiai rendszerek építése és átalakítása, mérnöki megközelítéssel. Szintetikus Biológia
  6. 6. David S. Goodsell
  7. 7. Alkalmazások Rendszerek Egységek Elemek DNS ACTGTGTGGGCTCGATATGTGTGTATTATGCATGCAT Mérnöki megközelítés
  8. 8. Szabványosított biológiai építőelemek leltára • 2003,Tom Knight, MIT • Biobrick Public Agreement • 2 000 kiosztott minta 2013-ban
  9. 9. International Genetically Engineered Machine Competition
  10. 10. Lehet-e Szintetikus Biológiával a szemetet átalakítani…
  11. 11. … ezekké?
  12. 12. PHB • Bakteriális energia-tár • Petrokémiai műanyag alternatíva • Biokompatibilis • Növényi anyagokból gyártják • Drága Negatívumok… PHB szemcse Bakteriális Bioműanyag
  13. 13. • Az SRF (visszanyert tüzelőanyag) az újra-hasznosító üzemek mellékterméke Tonnankent 24 000 Ft-ba kerul az SRF elszallitasa POWERDAY-rol Visszanyert Tüzelőanyag
  14. 14. 1/5 Műanyagok 4/5 Textil Fa Papír Miből van az SRF? Simon Little, Marketing Manager
  15. 15. 1: Bioműanyag Szemétből 2: Bioműanyag Újrahasznosítás 2. Rész1. Rész A project lényege
  16. 16. Tervezés Modellezés Epités Tesztelés Mérnöki folyamat
  17. 17. eredeti operon BBa_K934001 (Tokyo iGEM 2012), Control phaCAB Nilus-voros festes - PHB Tervezés
  18. 18. Metabolism Glucose 1 2 34 ModellezesModellezés
  19. 19. Metabolism Glucose 1 2 34 Modellezés
  20. 20. A PHB termeles PhaB-re erzekeny Sensitivity of [PHB] Time (minutes) Modellezés
  21. 21. Metabolism Glucose 1 2 34 Modellezés A PHB termeles PhaB-re erzekeny
  22. 22. P3HB Concentration (g/L) Modellezés Novekvo PhaB szint hatasa a PHB termelesre
  23. 23. BBa_K934001 + BBa_K608002 = BBa_K1149051 Epités BBa_K1149051
  24. 24. régi új Tesztelés
  25. 25. Tervezés Modellezés Epités Tesztelés Mérnöki folyamat
  26. 26. 1: Bioműanyag Szemétből 2: Bioműanyag Újrahasznosítás 2. Resz1. Resz A project lenyege
  27. 27. PHB előállítása szemétből M1: A baktériumokból kivont PHB Egy 3-HB orvosi assay kit sárga színreakcióval jelzi a PHB jelenlétét a mintákban Monomer detection Sarga szinreakcio a 3HB monomerek hatasara, PHB jelenletekor Control. Szintelen marad
  28. 28. Tervezés Modellezés Epités Tesztelés Mérnöki folyamat Emberi Alkalmazas
  29. 29. M.A.P.L.E. kuka
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.
