Assessment of cardiac microRNA high throughput sequencing data sets generated from RNA of varying quality - David T Humphreys
Upcoming SlideShare
Loading in...5
×
 

Assessment of cardiac microRNA high throughput sequencing data sets generated from RNA of varying quality - David T Humphreys

on

  • 876 views

Assessment of cardiac microRNA high throughput sequencing data sets generated from RNA of varying quality ...

Assessment of cardiac microRNA high throughput sequencing data sets generated from RNA of varying quality

Profiling microRNAs (miRNA) by high throughput sequencing (miRNA-Seq) provides quantification of expression level and reveals the complexity of processing variants. We recently published a software tool called miRspring which completely integrates miRNA-Seq data and sophisticated analysis tools into a HTML research document, and is functional without internet connectivity. Our initial use of the miRspring software was to establish quality parameters from 73 publically availably human miRNA-Seq data sets. In this study we have used the miRspring document to analyse miRNA-Seq data generated from cardiac biopsies taken from human patients at the time of LVAD (left ventricle assist device) implant and subsequent explant. The quality of RNA extraction from biopsies varied considerably with some preparations being significantly degraded (i.e. RIN scores < 6). We find that the established quality parameters identified from the publically available data sets were maintained in majority of data sets generated from degraded RNA. In particular there was no significant decrease in miRNA length and no appreciable increase in isomiRs or non-canonical processing across the data sets. This indicates that the degraded RNA preparations had intact miRNAs and are suitable for further analysis. From this analysis we find specific cardiac miRNAs to be upregulated at the time of explant indicating that transcriptional remodeling was occuring in hearts with LVAD support. We conclude that low quality RNA material can still be used for miRNA profiling if the appropriate quality control measures are implemented, and the miRspring software is proving to be a valuable tool for this analysis.

Statistics

Views

Total Views
876
Views on SlideShare
524
Embed Views
352

Actions

Likes
1
Downloads
8
Comments
0

12 Embeds 352

http://www.rna-seqblog.com 174
http://www.informaticsblogs.com 103
http://cloud.feedly.com 55
http://newsblur.com 5
http://www.inoreader.com 4
http://www.feedspot.com 3
http://www.linkedin.com 2
http://feedreader.com 2
http://digg.com 1
http://feeder.co 1
http://www.hanrss.com 1
http://feedly.com 1
More...

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Assessment of cardiac microRNA high throughput sequencing data sets generated from RNA of varying quality - David T Humphreys Assessment of cardiac microRNA high throughput sequencing data sets generated from RNA of varying quality - David T Humphreys Document Transcript

  • Assessment of cardiac microRNA high throughput sequencing data sets generated from RNA of varying quality. David T Humphreys1,2, Kavitha Muthiah1,3, Liza Thomas4, Peter Macdonald1,2,3, Chris Hayward1,2,3 1 Victor Chang Cardiac Research Institute, Sydney, Australia, 2St Vincent’s Clinical School, UNSW, Australia 3 St Vincent Hospital, Darlinghurst, Sydney, Australia, 4Liverpool Hospital, NSW, Australia A miRNA-Seq UGAGGUAGUAGGUUGUAUAGUU GAGGUAGUAGGUUGUAUAGUU pri-miRNA Drosha miRNA duplex pre-miRNA 3’ isomiRs let-7a let-7a -1 3’ isomiR vii OR Asymmetric RISC assembly miRNA miRNA * UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGUAGGUUGUAUAGU Ischemia hsa-miR-196a-3p-2 DICER hsa-miR-196a-5p 5’ isomiRs let-7a let-7a +1 5’ isomiR miRNA in the heart Exportin 5 hsa-miR-196a-3p-1 B B hsa-miR-196a-5p A miRNA biogenesis (miR-195, miR-320) Heart failure (miR-195, miR-23, Dicer) Fibrosis (miR-21, miR-29) RISC RISC seed isomiRs 5’ miR-196 UAGGUAGUUUCCUGUUGUUGGG let-7a +1 5’ isomiR GAGGUAGUAGGUUGUAUAGUU Translational repression 3’ mmu-mir-196a-1 5’ Myocardial infarction 3’ mmu-mir-196a-2 (miR-29) Naming nomenclature Precursor miRNAs: <species> – < mir > – <family ID> – <multi loci ID> Mature miRNAs: <species> – < miR > – <family ID> – <hairpin arm> – <multi loci ID> Figure 1: A) Many aspects of miRNA processing can be assessed from miRNA-Seq. These include (i) 5’ isomiRs, (ii) 3’ isomiRs, (iii) non-canonical processing, (iv) arm bias, (v) miRNA length, (vi) RNA editing, (vii) miRNA clusters. (B) Examples of the types of isomiRs that can be detected in miRNA-seq data sets. Note that both 3’ isomiRs and seed isomiRs have the same seed sequence. Bioinformatic analysis of miRNA-Seq data requires a good understanding of isomiRs, miRNA clusters and “multi-loci” miRNA. Ageing heart (miR-34a) Figure 2: A) miRNA are processed from longer transcripts (pri-miR, pre-miR) by class III RNases (Drosha, Dicer) into a 22bp miRNA duplex. One strand is preferentially loaded into the RNA induced silencing complex (RISC) and guides it to semi-complementary sequences.. miRNA can be degraded 5’ to 3’ by exonuclease activity. B) miRBase (www.mirbase.org), the central repository for miRNA sequences, stores two types of sequences : (i) the stem loop , containing the precursor miRNA sequence (eg brown text) and (ii) mature miRNAs (eg highlighted blue box). There is a defined naming nomenclature defined by miRBase. Figure 3: miRNAs are important in heart development and homeostasis. The miRNAs listed have been identified to be important for functional roles in key aspects of development/homeostasis. This is not a comprehensive list, the primary research articles implicating these miRNAs are referenced in the following reviews: Porrello ER (2013), Clin Sci 125(4):151-66 Small and Olson (2011), Nature 469:336-342. Callis and Wang (2008), Trends mol med 14(6):254-60 Figure is modified from Callis and Wang, 2008. Heart Failure miRspring document (miRNA sequence profiling) • Estimated prevalence of heart failure in Australia is 325,000 patients, >$1 billion (p/a) R. A. Clark, S. McLennan, A. Dawson, D. Wilkinson, S. Stewart, Heart Lung Circ 13, 266 (Sep, 2004). SCAN to load example miRspring document Web site: http://miRspring.victorchang.edu.au Enquires: miRspring@victorchang.edu.au Humphreys and Suter, 2013. Nucleic Acids Research 41(15):e147 • • • • miR-499 • Heart failures have a number of aetiologies. Diluted Cardiomyopathy (DCM) Hypertrophy Cardiomyopathy (HCM) Familial Congenital Idiopathic Post Partum Viral Chemotherapy Alcohol A bioinformatic solution to analyse miRNA-seq data sets. A HTML document that encodes a complete miRNA-seq data set. NO internet connectivity required. Has inbuilt research tools that provides detailed analysis of miRNA processing features. Perfect solution for supplementary information in publications Ischemia (Isch) 2cm (normal 1.2 – 1.5cm) B A • Four classes of NYHA heart failure: (New York Heart Association) 1) Cardiac disease but no symptoms and no limitation in ordinary physical activity (shortness of breath when walking, climbing stairs etc) 2) Mild symptoms (shortness of breath/angina) with exertion 3) Symptoms with exertion 4) Symptoms at rest heart transplant Ideal scenario Figure 4: (A) Software pipeline to creating a miRspring document. Three perl scripts are required to make a miRspring document), as well as data files accessible from the miRBase website (mature.fa, hairpin.fa and species.gff). (B) The miRspring document is significantly smaller than BAM files, but yet contains all the sequence information. miRspring: Visualisation & Data analysis A B Global visualisation mode Focused visualisation mode C Left ventricular assist device (LVAD) Figure 1a. HeartWare Figure Figure 1a. HeartWare 1a. HeartWare Figure 1b. HeartMate II Figure Figure 1b. HeartMate II 1b. HeartMate II • Implanted with the intention to bridge patient to heart transplantation. • Offered to individuals with severe end-stage heart failure in order to improve survival & quality of life • A mechanical circulatory device that replaces the function of a failing heart - Impeller part of device magnetically levitated and hydro-dynamically suspended - Deliver up to 10 L of blood per minute at 100mmHG - Placed with inflow cannula draining left ventricular cardiac apex, outflow cannula inserted into ascending aorta Hypothesis: There is miRNA remodelling in hearts with LVAD support D • • • Figure 5 Opening the miRspring document (in any internet browser) loads the (A) “Global” visualisation mode. This provides access to the raw counts of the whole data set in tabular or graphic format. Selecting points on the graph or a table entry will load (B) focused view which displays the sequencing information for that miRNA. C) The focus visualisation mode has a unique format to display sequences. D) QR code to a video screen cast on miRspring features. RESULTS: Assessment of public data sets We converted public data sets into miRspring documents and assessed what processing parameters were typical of a miRNA-seq data set. ~895 million sequence tags aligned to miRBase v19 precursors which were distributed across 73 miRspring documents needing less than 56 megabytes of disk space. Distribution of abundant miRNAs Key processing features Tissue taken at LVAD implantation (core section) and at explant (ie when patient receives heart transplant). 25 24 RIN vs miRNA length (nt) 100 RIN vs % 5’ isomiRs Sampling bias! BAM files produced from Lifescope small RNA pipeline miRNA profiling statistics calculated with miRspring software 100 RIN vs % 3’ isomiRs 80 60 40 Left Ventricle explants 40 20 Right Ventricle implants 20 0 Right Ventricle explants 0 ENCODE (as visualised in miRspring) 100 80 20 RIN vs % miRNA mapping 15 RIN vs % non-canonical processing 60 References for data sets: AGO IP: Burroughs, A.M. et al. RNA Biol 8, 158-177 (2011) TISSUE ATLAS: Cloonan, N. et al. Genome Biol 12, R126 (2011) ENCODE: Fejes-Toth, K. et al. Nature 457, 1028-1032 (2009) 40 RIN vs most abundant miR (%) 10 20 5 20 0 50 30 40 ALL data sets What is a RIN score? RIN score Individual data sets Key/Legend: Left Ventricle implants 60 19 HeLa S3 A549 Ag04450 Bj Gm1287 H1hesc HepG2 Huvec K562 MCF7 NheK Sknshra Next Generation Sequencing (SOLiD 5500xl) miRNA-seq QC analysis 80 20 Heart Kidney Liver Lung Ovary Spleen Testes Thymus Brain Placenta 300-1000ng total RNA input (NEB library prep kit) 12 cycles of PCR amplification QC analysis on agilent bioanalyzer To date we have collected and profiled miRNAs in 39 samples. For some preparations we recovered significantly degraded RNA. Degradation was measured by calculating the RNA integrity (RIN) scores with the Agilent Bioanalyzer. We examined if the miRNA population was comprimised in samples with low RIN scores. 21 THP-1 Library prep • • • Data analysis 22 Tissue Atlas RNA extraction Sequencing RESULTS: 23 AGO IP PROTOCOL (i) To implement quality control measures (ii) To measure differential miRNA expression in hearts, before and after LVAD implantation Tissues homogenized RNA purified using Qiagen miRNEasy kit QC analysis on agilent bioanalyzer • Tissue • • • • • AIMS Tissue collected within 5 minutes of coring/explant Tissue placed into RNAlater (Ambion) Snap frozen in liquid nitrogen. Stored at -80 C R2 = 0.56 10 0 0 RIN score Conclusions Conclusions • The hundred most abundant miRNAs are most likely to represent the entries as found in miRbase. • Less abundant miRNAs are more likely to have shorter lengths and non-canonically processed. We see negligible trends in miRNA processing in RNA of various RIN scores. This suggests that there is no significant: - 3’ to 5’ miRNA degradation (3’ isomiRs and miRNA length) - 5’ to 3’ miRNA degradation (5’ isomiRs) - Degradation of the precursor transcript (non-canonical processing) Acknowledgments Thanks to Djordje Djordjevic: for help getting up and running with the statistical package R, which was used to generate these results