0
GENE MAPPING - 3
By A.Arputha Selvaraj
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New J...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Contents
Genetic mapping: V...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Why map before sequencing?
...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Map-less sequencing: Bottom...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Figure 3.15 Genomes 3 (© Ga...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Figure 3.16 Genomes 3 (© Ga...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
From:
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
From:
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Figure 3.17 Genomes 3 (© Ga...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Mapping I
Mapping is identi...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Mapping II
Genetic mapping
...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping I
Based on ...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping II
Genetic ...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping example I
G...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping example II
...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping example III...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Figure 3.18 Genomes 3 (© Ga...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic markers
Genetic map...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Physical markers
Physical m...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
RFLP
Restriction-fragment l...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
SSLP/Microsatellites
• Simp...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
SNP
Single-nucleotide polym...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic map of Medicago tru...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Physical mapping
Determinat...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Physical Mapping Systems
(l...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Large insert vectors
Lambda...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pros and cons of large-inse...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
BACs and PACs
BACs and PACs...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Contigs
Contigs are groups ...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Contigs from overlapping
re...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Restriction mapping applied...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Analysis of restriction fra...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Gel image processing
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
FPC: fingerprint analysis w...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Building contigs by probing...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Chromosome walking
Combines...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequencing
All large-scale ...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequencing reaction
Chain-t...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequence detection
To detec...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequence separation
Termina...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Capillary electrophoresis
N...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequence reading of radioac...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequence reading of fluores...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Optical Mapping
• Single-mo...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pyrosequencing I
Based on p...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pyrosequencing II
To quanti...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pyrosequencing III
Sequenti...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pyrosequencing is a method ...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Who owns it?
Pyrosequencing...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Membrane sequencing
Single ...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
From http://www.foresight.o...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Summary I
Basics of mapping...
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Summary II
Basics of sequen...
Thank You
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Upcoming SlideShare
Loading in...5
×

GENE MAPPING 3

1,488

Published on

GENE MAPPING

Published in: Health & Medicine
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
1,488
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
68
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Transcript of "GENE MAPPING 3"

  1. 1. GENE MAPPING - 3 By A.Arputha Selvaraj © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
  2. 2. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Contents Genetic mapping: Virtual or relational mapping Physical mapping: systematic analysis Chromosome walking: find a gene on chromosome Determining DNA sequences: quick revision New techniques for mapping and sequencing
  3. 3. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Why map before sequencing? Major problem in large-scale sequencing: Current technologies can only sequence 600–800 bases at a time. We need to sequence 30 billion bp in order to perfectly sequence human genome One solution: make a physical map of overlapping DNA fragments: Top-Down approach Chromosomal libraries: 46 chromosomes/23 pairs Genomic library for many fragments from each chromosome Determine sequence of each fragment Then assemble to form contiguous sequence
  4. 4. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Map-less sequencing: Bottoms up Celera approach Alternative solution: fragment entire genome Sequence each fragment Assemble overlapping sequences to form contiguous sequence Focus here on principles and techniques of mapping and sequencing of the genomes
  5. 5. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Figure 3.15 Genomes 3 (© Garland Science 2007) Mitosis Chromatids
  6. 6. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Figure 3.16 Genomes 3 (© Garland Science 2007) Meiosis
  7. 7. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 From:
  8. 8. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 From:
  9. 9. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Figure 3.17 Genomes 3 (© Garland Science 2007)
  10. 10. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Mapping I Mapping is identifying relationships between genes on chromosomes Just as a road map shows relationships between towns on highway: fine maps Two types of mapping: genetic and physical
  11. 11. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Mapping II Genetic mapping Based on differences in recombination frequency between genetic loci: meiosis Physical mapping Based on actual distances in base pairs between specific sequences found on the chromosome Most powerful when genetic and physical mapping are combined
  12. 12. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic mapping I Based on recombination frequencies The further away two points are on a chromosome, the more recombination there is between them Because recombination frequencies vary along a chromosome, we can obtain a relative position for the loci Distance between the markers
  13. 13. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic mapping II Genetic mapping requires that a cross be performed between two related organisms The organism should have phenotypic differences (contrasting characters like red and white or tall and short etc) resulting from allele differences at two or more loci The frequency of recombination is determined by counting the F2 progeny with each phenotype
  14. 14. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic mapping example I Genes on two different chromosomes Independent assortment during meiosis (Mendel) No linkage Dihybrid ratio F1 9 : 3 : 3 : 1 F2 P
  15. 15. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic mapping example II Genes very close together on same chromosome Will usually end up together after meiosis Tightly linked F1 1 : 2 : 1 F2 P
  16. 16. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic mapping example III Genes on same chromosome, but not very close together Recombination will occur Frequency of recombination proportional to distance between genes Measured in centiMorgans =cM Recombinants Non-parental features One map unit = one centimorgan (cM) = 1% recombination between loci
  17. 17. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Figure 3.18 Genomes 3 (© Garland Science 2007) cM or centimorgan 1% Recombination = 1 cM
  18. 18. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic markers Genetic mapping between positions on chromosomes Positions can be genes Responsible for phenotype Examples: eye color or disease trait: limited Positions can be physical markers DNA sequence variation
  19. 19. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Physical markers Physical markers are DNA sequences that vary between two related genomes Referred to as a DNA polymorphism Usually not in a gene Examples RFLP SSLP SNP
  20. 20. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 RFLP Restriction-fragment length polymorphism Cut genomic DNA from two individuals with restriction enzyme Run Southern blot Probe with different pieces of DNA Sequence difference creates different band pattern GGATCC CCTAGG GTATCC GATAGG GGATCC CCTAGG 200 400 GGATCC CCTAGG GCATCC GGTAGG GGATCC CCTAGG 200 400* * 200 400 600 1 2 ** 2 1
  21. 21. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 SSLP/Microsatellites • Simple-sequence length polymorphism • Most genomes contain repeats of three or four nucleotides • Length of repeat varies due to slippage in replication • Use PCR with primers external to the repeat region • On gel, see difference in length of amplified fragment ATCCTACGACGACGACGATTGATGCT 12 18 1 2 2 1 ATCCTACGACGACGACGACGACGATTGATGCT
  22. 22. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 SNP Single-nucleotide polymorphism One-nucleotide difference in sequence of two organisms Found by sequencing Example: Between any two humans, on average one SNP every 1,000 base pairs ATCGATTGCCATGAC ATCGATGGCCATGAC2 1 SNP
  23. 23. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Genetic map of Medicago truncatula BMC Plant Biology 2002, 2:1doi:10.1186/1471-2229-2-1
  24. 24. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Physical mapping Determination of physical distance between two points on chromosome Distance in base pairs Example: between physical marker and a gene Need overlapping fragments of DNA Requires vectors that accommodate large inserts Examples: cosmids, YACs, and BACs
  25. 25. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Physical Mapping Systems (like a Filing system of clones) Yeast Artificial Chromosomes (YACs) 200-1000 kb Bacteriophage P1 90 kb Cosmids 40 kb Bacteriophage 9-23 kb Plasmids (2-6 kb)
  26. 26. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Large insert vectors Lambda phage Insert size: 20–30 kb Cosmids Insert size: 35–45 kb BACs and PACs (bacterial and P1 artificial chromosomes (Viral) respectively) Insert size: 100–300 kb YACs (yeast artificial chromosomes) Insert size: 200–1,000 kb
  27. 27. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Pros and cons of large-insert vectors Lambda phage and cosmids Inserts stable But insert size too small for large-scale sequencing projects YACs Largest insert size But difficult to work with due to instability
  28. 28. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 BACs and PACs BACs and PACs Most commonly used vectors for large-scale sequencing Good compromise between insert size and ease of use Growth and isolation similar to that for plasmids
  29. 29. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Contigs Contigs are groups of overlapping pieces of chromosomal DNA Make contiguous clones For sequencing one wants to create “minimum tiling path” Contig of smallest number of inserts that covers a region of the chromosome genomic DNA contig minimum tiling path
  30. 30. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Contigs from overlapping restriction fragments Cut inserts with restriction enzyme Look for similar pattern of restriction fragments Known as “fingerprinting” Line up overlapping fragments Continue until a contig is built
  31. 31. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Restriction mapping applied to large-insert clones Generates a large number of fragments Requires high-resolution separation of fragments Can be done with gel electrophoresis
  32. 32. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Analysis of restriction fragments Computer programs perform automatic fragment-size matching Possibilities for errors Fragments of similar size may in fact be different sequences Repetitive elements give same sizes, but from different chromosomal locations
  33. 33. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Gel image processing
  34. 34. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 FPC: fingerprint analysis window
  35. 35. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Building contigs by probing with end fragments Isolate DNA from both ends of insert and mix Label and probe genomic library Identify hybridizing clones Repeat with ends of overlapping clones
  36. 36. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Chromosome walking Combines probing with insert ends and restriction mapping First find hybridizing clones Then create a restriction map Identify the clone with the shortest overlap Make probe from its end Repeat process probe library probe library
  37. 37. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Sequencing All large-scale sequencing projects use the Sanger method Based on action of DNA polymerase Requires template DNA and primer Polymerase and nucleotides Polymerase adds nucleotides according to template Small amount of nucleotide analog included Stops synthesis
  38. 38. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Sequencing reaction Chain-termination method Uses dideoxy nucleotides When added in right amount, the chain is terminated Every time that base appears in template Need a reaction for each base: A, T, C, and G 3’ ATCGGTGCATAGCTTGT 5’ 5’ TAGCCACGTATCGAACA* 3’ 5’ TAGCCACGTATCGAA* 3’ 5’ TAGCCACGTATCGA* 3’ 5’ TAGCCACGTA* 3’ 5’ TAGCCA* 3’ 5’ TA* 3’ Sequence reaction products Template
  39. 39. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Sequence detection To detect products of sequencing reaction Include labeled nucleotides Formerly, radioactive labels used Now, fluorescent labels used Use different fluorescent tag for each nucleotide Can run all four bases in same lane TAGCCACGTATCGAA* TAGCCACGTATC* TAGCCACG* TAGCCACGT*
  40. 40. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Sequence separation Terminated chains need to be separated Requires one-base-pair resolution See difference between chain of X and X+1 base pairs Gel electrophoresis Very thin gel High voltage Works with radioactive or fluorescent labels A T C G – +
  41. 41. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Capillary electrophoresis Newer automated sequencers use very thin capillary tubes Run all four fluorescently tagged reactions in same capillary Can have 96 capillaries running at the same time 96–well plate robotic arm and syringe 96 glass capillaries load bar
  42. 42. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Sequence reading of radioactively labeled reactions Radioactively labeled reactions Gel dried Placed on X-ray film Sequence read from bottom up Each lane is a different base – + C A G T C A G T
  43. 43. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Sequence reading of fluorescently labeled reactions Fluorescently labeled reactions scanned by laser as a particular point is passed Color picked up by detector Output sent directly to computer
  44. 44. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Optical Mapping • Single-molecule technique Individual DNA molecules attached to glass support Restriction enzymes on glass are activated When DNA is cut, microscope records length of resulting fragments Has potential to rapidly generate restriction maps Optical mapping was developed at New York University in the late 1990s by David Schwartz, now a professor of chemistry and genetics at the University of Wisconsin-Madison. The method uses fluorescence microscopy to image individual DNA molecules that have been divided into orderly fragments by restriction enzymes.
  45. 45. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Pyrosequencing I Based on production of pyrophosphate during sequencing reaction Each time polymerase adds nucleotide (dNTP) to the growing strand, pyrophosphate (PPi) is released Amount released equal to number of nucleotides added QuickTime™ anda TIFF (Uncompressed) decompressor are needed to seethis picture. Ronaghi et al. (1998-07-17). "A sequencing method based on real-time pyrophosphate". Science 281: 363.
  46. 46. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Pyrosequencing II To quantitate amount of PPi released: ATP sulfurylase converts PPi to ATP ATP used by enzyme luciferase (firefly) to produce light from the substrate luciferin The amount of light produced is directly proportional to the amount of ATP, which is proportional to the amount of PPi released
  47. 47. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Pyrosequencing III Sequential addition of each dNTP gives sequence Apyrase enzyme used to degrade dNTPs after reaction completed Sequence read from amount of light emitted as each dNTP is added Nucleotide sequence Nucleotide added “pyrogram,”
  48. 48. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Pyrosequencing is a method of DNA sequencing based on the "sequencing by synthesis" principle. The technique was developed by Mostafa Ronaghi and Pål Nyrén at the Royal Institute of Technology in Stockholm in the 1990s. "Sequencing by synthesis" involves taking a single strand of the DNA to be sequenced and then synthesizing its complementary strand enzymatically. The Pyrosequencing method is based on detecting the activity of DNA polymerase (a DNA synthesizing enzyme) with another chemiluminescent enzyme. Essentially, the method allows sequencing of a single strand of DNA by synthesizing the complementary strand along it, one base pair at a time, and detecting which base was actually added at each step. The template DNA is immobilized, and solutions of A, C, G, and T nucleotides are added and removed after the reaction, sequentially. Light is produced only when the nucleotide solution complements the first unpaired base of the template. The sequence of solutions which produce chemiluminescent signals allows the determination of the sequence of the template. ssDNA template is hybridized to a sequencing primer and incubated with the enzymes DNA polymerase, , luciferase and apyrase, and with the substrates (APS) and luciferin. The addition of one of the four deoxynucleotide triphosphates (dNTPs)(in the case of dATP we add dATPαS which is not a substrate for a luciferase) initiates the second step. DNA polymerase incorporates the correct, complementary dNTPs onto the template. This incorporation releases pyrophosphate (PPi) stoichiometrically. ATP sulfurylase quantitatively converts PPi to ATP in the presence of adenosine 5´ phosphosulfate. This ATP acts as fuel to the luciferase-mediated conversion of luciferin to oxyluciferin that generates visible light in amounts that are proportional to the amount of ATP. The light produced in the luciferase-catalyzed reaction is detected by a camera and analyzed in a program. Unincorporated nucleotides and ATP are degraded by the apyrase, and the reaction can restart with another nucleotide. Currently, a limitation of the method is that the lengths of individual reads of DNA sequence are in the neighborhood of 300-500 nucleotides, shorter than the 800-1000 obtainable with chain termination methods (e.g. Sanger sequencing). This can make the process of genome assembly more difficult, particularly for sequence containing a large amount of repetitive DNA. As of 2007, pyrosequencing is most commonly used for resequencing or sequencing of genomes for which the sequence of a close relative is already available.
  49. 49. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Who owns it? Pyrosequencing AB in Uppsala. Sweden, was started to commercialize the machine and reagent for sequencing of short stretches of DNA. Pyrosequencing AB was renamed to Biotage in 2003. Pyrosequencing technology was further licensed to 454 Life Sciences. 454 developed an array-based Pyrosequencing which has emerged as a rapid platform for large-scale DNA sequencing. Most notable are the applications for genome sequencing and metagenomics. GS FLX, the latest pyrosequencing platform by 454 Life Sciences (owned by Roche), can generate 100 million nucleotide data in a 7 hour run with a single machine. It is anticipated that the throughput would increase by 5-10 fold with the next release. Each run would cost about 5,000-6,000 USD, pushing de novo sequencing of mammalian genomes into the million dollar range.
  50. 50. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Membrane sequencing Single DNA molecules pass through pore in membrane Each nucleotide has slightly different charge Charge detected as nucleotides pass through membrane Many problems need to be worked out before this method can be used for genomic sequencing
  51. 51. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 From http://www.foresight.org/Nanomedicine/Sequencing.html Nov. 1996 "Characterization of individual polynucleotide molecules using a membrane channel" (John J. Kasianowicz, Eric Brandin, Daniel Branton, David W. Deamer) Nov. 1998 "Use of a Single Nanometer-Scale Pore to Rapidly Examine Individual DNA or RNA Strands" (Mark Akeson, Daniel Branton, John J. Kasianowicz, Eric Brandin, David W. Deamer) Dec. 1999 "Microsecond time-scale discrimination among polycytidylic acid, polyadenylic acid, and polyuridylic acid as homopolymers or as segments within single RNA molecules" (M. Akeson, D. Branton, J.J. Kasianowicz, E. Brandin, D.W. Deamer) Abstract Paper Feb. 2000 "Rapid nanopore discrimination between single polynucleotide molecules" (Amit Meller, Lucas Nivon, Eric Brandin, Gene Golovchenko, Daniel Branton) Apr. 2000 "Nanopores and nucleic acids: prospects for ultrarapid sequencing" (D.W. Deamer, M. Akeson) Abstract Sep. 2000 "Nanopore Sequencing. Probing Polynucleotides with a Nanopore: High Speed, Single Molecule DNA Sequencing" (Daniel Branton, Jene Golovchenko)
  52. 52. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Summary I Basics of mapping Genetic mapping Based on recombination frequencies Physical mapping Requires overlapping DNA fragments Can use restriction enzymes Probing with end fragments Combination: chromosome walking
  53. 53. © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458 Summary II Basics of sequencing Chain-termination method Radioactive or fluorescent labels Separated by gel or capillary electrophoresis Read from X-ray film or by laser detector New technologies Optical mapping Pyrosequencing Membrane sequencing
  54. 54. Thank You © 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×