Managing Objectionable Events in cGMP Cleanrooms: A Polyphasic Approach.
 

Managing Objectionable Events in cGMP Cleanrooms: A Polyphasic Approach.

on

  • 563 views

Managing Objectionable Events in cGMP Cleanrooms: A Polyphasic Approach. ...

Managing Objectionable Events in cGMP Cleanrooms: A Polyphasic Approach.

New technologies are finding far more organisms than before, creating the need for a rational, comprehensive approach to environmental monitoring.

BY J.S. SIDHU, C.T. TYLER, G. MA, AND M. SAMADPOUR, MOLECULAR EPIDEMIOLOGY, INC., AND E.J. BRANDRETH, ALTHEA TECHNOLOGIES

Statistics

Views

Total Views
563
Views on SlideShare
561
Embed Views
2

Actions

Likes
1
Downloads
8
Comments
0

2 Embeds 2

http://www.linkedin.com 1
https://www.linkedin.com 1

Accessibility

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Managing Objectionable Events in cGMP Cleanrooms: A Polyphasic Approach. Managing Objectionable Events in cGMP Cleanrooms: A Polyphasic Approach. Document Transcript

  • E N V I R O N M E N TA L M O N I T O R I N G BY J.S. SIDHU, C.T. TYLER, G. MA, AND M. SAMADPOUR, MOLECULAR EPIDEMIOLOGY, INC., AND E.J. BRANDRETH, ALTHEA TECHNOLOGIESIN BIOPHARMACEUTICAL manufacturing, an ac- manufacturers to take more rational and manageablecurate and comprehensive knowledge of the entire process approaches to environmental montioring.flow is a critical part of a thorough cGMP microbial We recommend a polyphasic approach, one thatcontrol program. The goal is to have precise data highlight- makes use of key characteristics or properties of aing where incursion points may exist, and control those particular unknown organism in tandem with itspoints to limit or prevent migration into the process flow. genetic information. Such an approach provides a moreHistorically, the identification of cleanroom environmental definitive taxonomic identification; it also avoids themonitoring (EM) isolates has been limited to the genus orgroup level for most organisms, with some ability to pro- Genetic IDvide species level identification only if absolutely required. Comparisons to genetically similar microorganisms Recently, rapid technologies have become Genetic Distance Genus Speciesavailable, especially DNA-sequencing based systems,to more quickly identify microorganisms. These 0.000 Shigella sonneitechniques can help manufacturers to understand and 0.000 Shigella flexneriinvestigate potential physical and temporal sources 0.000 Escherichia coliof contamination. However, while such genetic-based 0.000 Shigella boydiisystems may be rapid, they are still inherently limitedby their inability to discriminate between species and 0.000 Escherichia sp.some genera in some critical categories. Additionally, 0.007 Enterobacter hormaecheian identification match is only possible if the organism 0.0019 Shigella dysenteriaeand its reference are adequately differentiated and in 0.0022 Enterobacter sp.the manufacturers’ database. Thus, with this increasein technology comes the likelihood of identifying 0.0031 Cronobacter sakazakiia far greater number of potentially “objectionable” 0.0081 Citrobacter freundiienvironmental organisms (e.g., coliforms, pathogens) 0.0090 Enterobacter dissolvensthan ever before, as well as challenges in knowing what todo with the additional data. 0.0100 Kiebsiella oxytoca It’s important, therefore, that new tools and the data Microbial ID Family: Enterobacteriaceaethey produce not take precedence over the practical Conclusionapplication of good microbiological practices. If Figure 1. Genetic-based identification reported the unknown isolate asanything, these technologies increase the necessity for “Family: Enterobacteriaceae.”
  • E N V I R O N M E N TA L M O N I T O R I N G Since the polyphasic determination presented the EM isolate as belonging to the same genus and species as the MCB and was a potentially objectionable organism (coliform), further analysis of its potential for pathogenicity was required. The process included targeted PCR analysis of toxins as well as attachment factors associated with recognized pathogenic forms, such as Enterotoxigenic E. coli (ETEC), Shiga-toxin producing E. coli (STEC), Enterohemorrhagic E. coli (EHEC), and Enteropathogenic E. coli (EPEC), or closely related species such as Shigella spp.Figure 2. Polyphasic Microbial Identification (PMID) identified the isolate as Escherichia coli. The following organisms were used for Quality Control purposes in theIdentities = 416/418 (99%), Gaps = 1/418 (0%) various analytical tests performed: E. coli ATCC 8739, Shigella sonneiE. coli O157 23 ATCC 25931, Klebsiella pneumoniae ACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACAC 82 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||E. coli K-12 213094 ACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACAC 213035 ATCC 10031, and Klebsiella oxytocaE. coli O157 83 GCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGT 142E. coli K-12 213034 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGT 212975 ATCC 43863. These were obtainedE. coli O157 143 AGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGG 202 as lyophilized cultures, reconstitutedE. coli K-12 212974 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGG 212915 and sub-cultured as recommendedE. coli O157 203 ATCGTCGCCTAGGTGAGCCGTTACCCCACCTACTAGCTAATCCCATCTGGGCACATCCGA 262 for isolated colonies. The study ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||E. coli K-12 212914 ATCGTCGCCTAGGTGAGCCGTTACCCCACCTACTAGCTAATCCCATCTGGGCACATCCGA 212855 was further supplemented withE. coli O157 263 TGGCAAGAGGCCCGAAGGTCCCCCTCTTTGGTCTTGCGACGTTATGCGGTATTAGCTACC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 322 ATCC-derived strains, EnterobacterE. coli K-12 212854 TGGCAAGAGGCCCGAAGGTCCCCCTCTTTGGTCTTGCGACGTTATGCGGTATTAGCTACC 212795 cloacae ATCC 23355, PseudomonasE. coli O157 323 GTTTCCAGTAGTTATCCCNNCTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGC |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| 382 aeruginosa ATCC 9027, E. coli ATCCE. coli K-12 212794 GTTTCCAGTAGTTATCCCC-CTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGC 212736 25922 and E. coli O157:H7 ATCCE. coli O157 383 CACTCGTCAGCAAAGAAGCAAGCTTCTTCCTGTTACCGTTCGACTTGCATGTGTTAGG 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 35150, from MEI’s QC collection asE. coli K-12 212735 CACTCGTCAGCAAAGAAGCAAGCTTCTTCCTGTTACCGTTCGACTTGCATGTGTTAGG 212678 well as two additional E. coli strainsFigure 3. Alignment comparison of partial 16S rRNA genetic sequence from platform strain E. coli from lab and environmental sources.K-12 with genetic sequence from pathogenic strain E. coli O157:H7. Note that >99 percent homol- Additionally, Althea submittedogy at this sequence length is considered as indistinguishable. an isolate of the Master Cell Bank platform strain used in processing.pitfalls of potentially misidentifying combining a genetic-based microbial Representative cultures of eachorganisms due to the limitations ID assay (16S rRNA sequencing) with microorganism were subjected toof various commercial phenotypic a broad spectrum for phenotypic and 16S rRNA sequencing, colonial,and genotypic microbial ID systems biochemical analyses, to accurately morphological, biochemical (Vitekand their databases. This article identify a potentially objectionable GNI, bioMérieux) observations andwill detail such an approach taken environmental organism submitted DNA fingerprinting using pulsedrecently during work at facilities of by Althea. The organism of con- field gel electrophoresis (PFGEAlthea Technologies in San Diego. cern was recovered during routine analysis—with restriction enzymes environmental monitoring, while XbaI, AvrII and SpeI). Analysis ofAN ORGANISM OF CONCERN aliquoting in a tissue culture hood. toxigenic and pathogenic potentialIn the current study, Molecular The procedure involved a biofermen- was conducted using a proprietaryEpidemiology Inc. (MEI) used a tation Master Cell Bank (MCB), with polymerase chain reaction (PCR)polyphasic identification approach, Escherichia coli as the platform. method (MEI, 2010) to determine the44 MAY 2012
  • E N V I R O N M E N TA L M O N I T O R I N GFigure 4. PCR results for various targetedmarker genes: upper image shows recoveryof genomic DNA (lane 8, negative, is buffercontrol); middle image shows GAPDH targetspecific to members of Enterobacteriaceae(note lane 5, negative, is Pseudomonas aeru-ginosa); lower image shows recovery of targettoxin and attachment genes in control strain E.coli O157:H7 (lane 7); lane 2 is study strain.presence or absence of toxin markersand pathogenicity factors in thereference and subject strains.CONFIRMING IDENTIFICATIONAn initial isolate recovered from acleanroom sanitary fill operation(aliquoting of MCB) was received foridentification by 16S rRNA genetic Figures 5a, 5b, 5c. A comparison of genetic sub-typing patterns of entire genomes by pulsed fieldsequencing. The isolate was reported gel electrophoresis showing distinctly different patterns between EM isolate (Althea Tech.) andas a member of the Family Entero- other E. coli, pathogenic forms of E. coli and other selected pathogens and non-pathogens in Fam-bacteriaceae (Figure 1)—consistent ily Enterobacteriaceae. Note the indistinguishable patterns of EM isolate and Platform E. coli underwith the industry and federally conditions of three different restriction enzymatic digests: XbaI, AvrII, and SpeI.recognized guidelines (CLSI, 2008)for genetic sequencing techniques culture of E. coli O157:H7 ATCC (PCR) analyses for specificallyfor identification. Further taxonomic 35150. Furthermore, sequence targeted toxigenic and pathogenicclassification was required, and the alignment data (Figure 3) indicate markers demonstrated the absenceapplication of a polyphasic micro- the indistinguishable similarity of these markers in the submittedbiological ID (PMID) method clearly in the 16S rRNA gene sequence organism (Figure 4, lane 2) whendifferentiated and reported the associated with the pathogenic compared to the control organismsisolate as E. coli (Figure 2). species. Therefore, reliance on (Figure 4, lane 7). Further comparisons with related genetic-based ID or even a microbial Subsequent to the PMID of the EMstrains with pathogenic potential ID conclusion would not rule out the isolate as E. coli, DNA Fingerprintingdifferentiated and confirmed this possibility of a frank pathogen. comparison of the entire genomeidentification (data not shown). Of To confirm that the EM isolate by PFGE analysis (employing threeconcern was the equally identical had not acquired any pathogenic distinct restriction enzyme digests)taxonomic ID presented by the QC potential, polymerase chain reaction demonstrated the differences in
  • E N V I R O N M E N TA L M O N I T O R I N G Coliform in Classified Area the facility is verified to be operating with suitable environmental control Microbial Identification regarding the detection of coliforms. Polyphasic Microbial ID Genetic ID EM AND EXCURSION RESPONSE A company should have an estab- Species Level ID: E. coli Family Level Output: lished SOP which clearly identifies Enterobacteriaceae the actions to be taken, includingStrain Characterization Toxigenicity and clear directions if and when regula- Species/Strains of Note by PFGE Pathogenicity analysis by PCR tory notification (FDA, USDA, CDC, etc.) would be required. In many cas-Match to Platform Strain No toxin or pathogen Shigella sonnei E. coli O157:H7 (and other es, the detection of an enteric organ- markers detected pathogenic serotypes) ism or a frank pathogen may include No Risk Undefined Risk the determination of non-pathoge- nicity, or absence of virulence factors and potential for toxigenicity, which Figure 6. MEI’s proprietary Polyphasic System Approach CAPA allows the manufacturer to better (PSA) towards the investigation of a potential “objection- manage associated risk. The key is to able” organism. understand the process and potential incursion points, and to complement genetic profiles from other similarly demonstrated to be unequivocally them with Corrective Action/Preven- named control and environmental non-pathogenic and non-toxigenic tive Action, based on the potential strains (Figures 5a, 5b, 5c). by PCR analysis of pathogenic and toxigenicity or pathogenicity of The isolate under investigation toxigenic potential. The entire pro- the organism. This, coupled with a is identified in the dendrograms cess using a thorough science-based science-based Risk Assessment, al- and its genomic pattern is clearly evaluation is illustrated in Figure 6. lows for a more rigorous evaluation distinguishable from the other As such, this isolate was not of potential EM excursions. strains and yet indistinguishable an “objectionable” organism. The from the Master Cell Bank platform manipulation of the fermentation References strain. This, having already strain—sampling, pipetting with 1. Clinical Laboratory Standards Institute. demonstrated the strain’s lack of expected minute aspirations, etc.— Interpretive Criteria for Identification associated pathogenicity, confirms its can lead to isolated incidents of of Bacteria and Fungi by DNA Target clonal relationship with the MCB. detection of the bioprocess strain Sequencing: Approved Guideline. CLSI in any well-controlled facility. document MM18-A. Wayne, PA, 2008. BIOPROCESS STRAIN: A SCI- The results presented here show 2. Molecular Epidemiology, Inc. dba IEH ENCE-BASED EVALUATION the benefits of polyphasic ID Laboratories & Consulting Group. IEH In our study, the detection of an E. and the limitations of genetic or E. coli O157, Stx-producing E. coli, (STEC) coli recovered during environmen- phenotypic (rapid) microbial ID with Intiman and Salmonella Test System. tal/production monitoring in the methods when used individually. AOAC-RI PTM 100701, AOAC Research tissue culture hood was cause for Incorrect, incomplete or inadequate Institute, Gaithersburg, MD, USA, 2010. thorough and appropriate investiga- identification and characterization tion. Through the use of a detailed of strains of E. coli cannot exclude About the Authors polyphasic analysis approach, the potential pathogenic forms such as Jaspreet S. Sidhu, Ph.D. (VP, Business Devel- isolate was verified to be the same specific pathogenic serotypes (e.g., opment and Pharmaceutical Microbiology), taxonomic genus and species as the O157; O104), Enterohemorrhagic Connor Tyler (Scientist), Greg Ma (Director bioprocess strain. Further testing via strains (EHEC) as well as E. coli of General Microbiology), and Mansour Sa- DNA fingerprinting by pulsed field subtypes STEC, ETEC, and EPEC, madpour, Ph.D. (President, CEO) represent gel electrophoresis demonstrated respectively. By detailed polyphasic Molecular Epidemiology, Inc. in Lake Forest that this was indeed the exact same analysis and demonstrating that any Park, Washington. E.J. Brandreth is VP of strain as used in the fermentation isolate of E. coli is linked directly to Quality and Regulatory Affairs for Althea process. In addition, the strain was the upstream production process, Technologies, San Diego. 46 MAY 2012