• Save
Bert Reijmerink (Genalice) - Hoe technologie bijdraagt aan een betere behandeling van kankerpatiënten
Upcoming SlideShare
Loading in...5
×
 

Bert Reijmerink (Genalice) - Hoe technologie bijdraagt aan een betere behandeling van kankerpatiënten

on

  • 1,149 views

Presentatie van Bert Reijmerink (Genalice) - 'Hoe technologie bijdraagt aan een betere behandeling van kankerpatiënten' tijdens het Big Data Analytics seminar 14 juni in Almere

Presentatie van Bert Reijmerink (Genalice) - 'Hoe technologie bijdraagt aan een betere behandeling van kankerpatiënten' tijdens het Big Data Analytics seminar 14 juni in Almere

Statistics

Views

Total Views
1,149
Slideshare-icon Views on SlideShare
1,013
Embed Views
136

Actions

Likes
0
Downloads
2
Comments
0

4 Embeds 136

http://www.almeredatacapital.nl 130
http://almeredatacapital.nl 4
http://webcache.googleusercontent.com 1
https://twitter.com 1

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Bert Reijmerink (Genalice) - Hoe technologie bijdraagt aan een betere behandeling van kankerpatiënten Bert Reijmerink (Genalice) - Hoe technologie bijdraagt aan een betere behandeling van kankerpatiënten Presentation Transcript

    • Hoe technologie bijdraagt aan een betere behandeling van kankerpatiënten Bert Reijmerink Chief Executive Officer Confidential 1
    • THE FIRST AND FASTESTS OPEN BIG MEDICAL DATA ANALYSIS PLATFORM INTEGRATING & CORRELATION BIOMEDICAL DATA2 Copyright © 2012 Genalice B.V.
    • OUR DREAM TO SAVE LIVES AND IMPROVE QUALITY OF LIFEOF CANCER PATIENTS 3
    • DNA technology is moving at high pace Medical data is produced with high speed13 Years 2 months 8 days <1 hour$3,000,000,000 $2,000,000 $10,000 $1,000 2003 2007 2012
    • BUT… data ≠ knowledge & insights As is needed to improve patient careTTTATCGGAATCCGATTTCGAAACTGGGTATATCCCGGGGAAATCTCGTATAGCTCTCGAGCTCTCGCAAAATTTTTCTCCGCGCGCTTTGATGCATCGGCTACGATCGTAGCTACGACGATGCTACGCTAGTGGGGGTATTTCTATCACACACAAACACGATCGTAGCTGTTTTTTCCCCCGGGTGTGTACGATCAAACGACTGACTACGATCGATCGATCGATCAGCTAGCTACGACTGACTAGCTGACTAGCTAGCTAGCTAGCTAGCTACGTAGCTACGATCGATCGATCGATCGATCGATCGATCGACGGATGTGGTGTGTTTCTTTTTCTTCAAAAAACCAACACATCGATCGACTGTACGATCGATGCTACGTAGCATCGATCGATCACGTCAGATCGATGCTACGATCGCGATCGGATCGATCGATCGATGATCGATCATTTCGCGTCCATTTTCCGCTTCGGGATTTGATGATCGCGGTTTTATAGCTAGTTA……. 3 billion in total = 25 TB 5
    • At the brink of BIG changesEnabled through advances in DNA production and by powerful data analysis Confidential 6
    • High-Throughput Sequencing goes global Approximate number of machines (by country) Confidential 7
    • DNA data production is Skyrocketing Number of sequenced full human genomes Confidential 8
    • Big change – Big opportunity According to McKinseyU.S. healthcare sector could create more than $300 billion in value every year if it were to “use bigdata” creatively and effectively to drive efficiency and quality McKinsey, 2011
    • The medical BIG DATA challengeUp to 45 TB of diagnostic data per patient from different sources Gene Expression DNA variations Proteomics Clinical Data Pathology Imaging Any other dataset Confidential 10
    • Research is still moving a slow pace Key issues that slow down clinical applicationsNon-integrated Selective Separate Confidential 11
    • Technology is the solution To boost research and improved patient treatmentIntegrated data processing & analysis software: Master the size Master the format Master the compute Facilitate cooperation Confidential 12
    • Reducing the size of DNA data Enables high volume analysesFull genome sequence: Alignment output file: Genalice format: ± 25 Terabytes ± 1.2 Terabytes ± 200 Megabytes DNA data production Preprocessing Downstream analysis Confidential 13
    • Transform and uniform dataAllows for diagnostic multi-domain integration DNA variations Gene Expression Proteomics Imaging INTEGRATION Clinical Data Pharmaco- genomics Pathology 14
    • Integration of existing knowledge oProvides a 360 view of a patient’s specific disease and boosts research DNA variations Gene Expression Proteomics Imaging INTEGRATION Clinical Data Pharmaco- genomics Pathology 15
    • Unraveling multi-domain correlations Will boost discovery towards 1st time right treatment DNA variations Gene Expression Proteomics INTEGRATION Imaging Cancer Treatment Clinical Data Pharmaco- genomics Pathology 16
    • Micro parallel processing Warrants high performance analysis WeeksTime to result Seconds Confidential 17
    • Micro parallel processing Warrants high performance analysisNumber of patients in one run 100K-1M 10-50 Confidential 18
    • Facilitating high volume data sharing A power multiplier for biomarker discovery projects 19
    • Biomarkers: from research to clinic High volume data internally validates digitally stored biomarkers DNA variations Gene Expression Proteomics INTEGRATIONImaging RESEARCH Biomarker Biomarker Check Find ClinicClinical Data validation value value Any other dataset Pathology 20
    • Game changing technology and approach Containing six patentable new techniques Uniform Format Data Selection Data Movement Causality/Correlation Pattern Index NB micro Scheduler Confidential 21
    • Our technology facilitates Faster Diagnosis (within 24 hrs)Reliability Targeted Treatment (1st time right) Joint EffortEfficiency Time/Resources gains in ResearchCost Improved Drug Development Confidential 22
    • Why is Genalice worth working with? Market at the brink to explode Best positioned company to capture major share Groundbreaking technology and approach Excellent team and network Potential use in other diseases & markets Confidential 23
    • Potential use in other diseases and markets As our software is a generic BIG DATA cruncher1. Oncology market (largest medical segment)2. Application for other diseases McKinsey BIG DATA Report 20113. Other applications (outside the medical field) Confidential 24
    • Partners & launching customers University hospital Maastricht Amsterdam Confidential 25
    • Excellent team and network The Jockeys Bert Reijmerink Hans Karten Jos LunenbergChief Executive Officer Chief Technology Officer Chief Business OfficerSenior Business Developer IT Senior Development Oracle Master Degree Molecular 11 patents Biology & MBA International Marketing Health/Life Science Confidential 26
    • Excellent team and network Our scientific advisory boardAmsterdam Prof. Gerrit Meijer Prof. Edwin Cuppen VUMC Amsterdam UMC Utrecht PrincipaI Investigator TraIT (CTMM) Head of Research Medical Genetics Confidential 27
    • Excellent team and network Our first board member RONALD BRUS, MD Former positions: CEO of Crucell (sold to J&J for 2.4B) Board member Galapagos (listed AMEX) Confidential 28
    • Genalice supports Alpe d’Huzes Chirurgen tegen kanker Confidential 29