Bio conference live 2013

302
-1

Published on

Published in: Health & Medicine, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
302
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
9
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Bio conference live 2013

  1. 1. What to use for targeted re- sequencing – microarrays or Next Generation Sequencing? Agnieszka M. Lichanska TPCaruso & associates, Durham, NC Choices  for  gene-c  tes-ng  
  2. 2. Content 1.  Learning objectives 2.  What is re-sequencing? •  Why do we use it? •  When do we use it? •  What are the types of re-sequencing methods? 3.  Technologies used for re-sequencing – technical comparison •  Workflows •  Comparison of performance •  Data analysis 4.  Establishment of a new assay in the laboratory •  Requirements •  Validation •  Reference materials •  Reporting and interpretation •  Regulatory oversight 5.  Summary 6.  Questions TPCaruso & associatesBioConference Live Genetics and Genomics 2013
  3. 3. Learning Objectives 1.  Understand how targeted re-sequencing is applied to genetic screening 2.  Appreciate the complexity of validation protocols for re-sequencing assays. BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  4. 4. Re-sequencing •  It is sequencing of a part or whole genome of an individual in order to detect sequence differences between the individual and the standard genome of the species BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  5. 5. Re-sequencing •  When to use it? o  Carrier screening o  Prenatal screening o  Newborn screening o  Undiagnosed childhood diseases/disorders o  Risk assessment for complex diseases •  Types of methods used: o  Targeted re-sequencing panels o  Exome sequencing o  Whole genome sequencing •  Applications: o  Genotyping o  Variation screening BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  6. 6. How to perform targeted re-sequencing? BioConference Live Genetics and Genomics 2013 TPCaruso & associates Exon   Regulatory  region   Amplicon   Flanking  region   Buffer  region   Primer   Target   Amplicons   Probe   Gene  X,  area  of  interest   DNA   Beads   Gene  X,  area  of  interest   DNA   Array   Probe   In  solu(on  capture   On  array  capture   PCR  amplifica(on   MPX  PCR  &  LR_PCR   RainDance  ePCR   Fluidigm   Haloplex   Ion  Torrent   Illumina  
  7. 7. Changing face of genetic testing BioConference Live Genetics and Genomics 2013 TPCaruso & associates Complexity   Number  of  genes   1   >10,000   10   100   1000   Low   Medium   High   Sanger   Arrays   NGS  
  8. 8. Assays available for targeted re-sequencing BioConference Live Genetics and Genomics 2013 TPCaruso & associates Technique   Assays   Sanger  Sequencing   ABI  Resequencing  Sets  (RSSs)   Array-­‐based  high-­‐throughput  re-­‐ sequencing  strategies   Pan-­‐Ethnic  Carrier  Screening  Panel   *Noonan  Syndrome   *Cardiac  myopathy   *Charcot-­‐Marie  Tooth   Next  GeneraUon  Sequencing   Carrier  screening  panel,  incl.  CFTR  panel   Noonan  syndrome  panel   Cardiac  diseases  panel   Pharmacogenomics  panel   Intellectual  disability   AuUsUc  disease  spectrum  panel   Pulmonary  diseases  panels   NeurodegeneraUve  disorders   MulUple  cancer  panels  and  more   *  The  assay  is  no  longer  used,  transiUoned  to  NGS  
  9. 9. TECHNICAL COMPARISON BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  10. 10. Re-sequencing microarrays •  Formats and total number of bases that can be sequenced o  Cartridge: o  49 format – 317 kb o  100 format – 117 kb o  169 format – 47 kb o  Strips of 4 chips o  96-well plates of chips (High Throughput Assay or HTA) BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  11. 11. TPCaruso & associates 1234! GAGACGGATTCTCCGCCGAGCTGTCCGATACG! CTCTGCCTAAGAGGCGGCTCGACAGGCTATGC! Reference sequence Patient’s Sample sequence GAGACGGATTCTCCACCGAGCTGTCCGATACG! ------------GGTG----------------! GAGACGGATTCTTCGCCGAGCTGTCCG! GAGACGGATTCTGCGCCGAGCTGTCCG! GAGACGGATTCTCCGCCGAGCTGTCCG! ------------GGTG-----------! GAGACGGATTCTACGCCGAGCTGTCCG! AGACGGATTCTCTGCCGAGCTGTCCGA! AGACGGATTCTCGGCCGAGCTGTCCGA! AGACGGATTCTCCGCCGAGCTGTCCGA! -----------GGTG------------! AGACGGATTCTCAGCCGAGCTGTCCGA! GACGGATTCTCCTCCGAGCTGTCCGAT! GACGGATTCTCCGCCGAGCTGTCCGAT! GACGGATTCTCCCCCGAGCTGTCCGAT! GACGGATTCTCCACCGAGCTGTCCGAT! ----------GGTG-------------! ACGGATTCTCCGTCGAGCTGTCCGATA! ACGGATTCTCCGGCGAGCTGTCCGATA! ACGGATTCTCCGCCGAGCTGTCCGATA! ---------GGTG--------------! ACGGATTCTCGCACGAGCTGTCCGATA! Base # 1 Base # 2 Base # 3 Base # 4
  12. 12. Re-sequencing microarrays difficult sequences BioConference Live Genetics and Genomics 2013 TPCaruso & associates GAGACGGATTCTCCGCCGAGCTGTCCGATACG! CTCTGCCTAAGAGGCGGCTCGACAGGCTATGC! Reference sequence GAGACGGATTCTCC---GAGCTGTCCGATACG! ------------GG---CTC------------! GAGACGGATTCTCCGTTTCCGAGCTGTCCGATACG! ------------GGCAAAGGCTC------------! GAGACGGATTCTCCGCCGAGCTGTCCGATACG! CTCTGCCTAAGAGGCGGCTCGACAGGCTATGC! Reference sequence GAGACGGATTCTCCTCCTCCGGGGGGTCCGATACG! CTCTGCCTAAGAGGAGGAGGCCCCCCAGGCTATGC! GAGACGGATTCTCCTCCTCCGGGGGGGGTCCGATACG! CTCTGCCTAAGAGGAGGCAGCCCCCCCCAGGCTATGC! Repeats Single base changes in homopolymer stretches Insertions Deletions Large deletions Exon  1   Exon  2   Exon  3  
  13. 13. Next Generation Sequencing BioConference Live Genetics and Genomics 2013 TPCaruso & associates 36  -­‐  250bp   Up  to  200bp   Up  to  1000bp   50  –  75bp   Up  to  20,000bp   Fluorescence   H+  ion  detecUon   Luminescence   Fluorescence   Fluorescence   Bridge   amplificaUon   ePCR   ePCR   ePCR   No   amplificaUon   Homopolymer   errors   Homopolymer   errors   slow   Low  yield  at   high  accuracy   Signal/Noise   RaUo   Sequence  
  14. 14. Sequencing workflows – Microarray vs NGS BioConference Live Genetics and Genomics 2013 TPCaruso & associates DNA  FragmentaUon   Sequencing   Data  Analysis   ReporUng   gDNA  template   MPX  PCR  amplificaUon   Pooling,  purificaUon,     FragmentaUon,  labeling   HybridizaUon   Wash  &  stain   Scanning   Targeted  enrichment:*   Capture  or  amplificaUon   Tagging  of  the  fragments*     *  Order  of  steps  varies  on  a   protocol  used   Microarray NGS
  15. 15. NGS output example BioConference Live Genetics and Genomics 2013 TPCaruso & associates CTTACAGATATGTGTTGAGACGGATTCTCCGCCGAGCTGTCCGATACGCCCATGAAAAGCT! AARS  c.986G>A   CTTACAGATATCTGTTCA   CTTACAGATATCTGTTGAGA   CTTACAGATATCTGTTGAGACGGAT   CTTACAGATATCTGTTGAGACGGAT   CTTACAGAAATCTGTTGAGACGGAT   CTTACAGATATCTGTTGAGACGGATTCT   CTTACAGATATCTGTTGAGACGGATTCTCC   CAGATATCTGTTGAGACGGATTCTCCACCG   CAGATATCTGTTGAGACGGATTCTCCACCG   GATATCTGTTGAGACGGATTCTCCACCGAG   ATAT-TGTTGAGACGGATTCTCCACCGAGC   GATATCTGTTGAGACGGATTCTCCACCGAG   TGTTGAGACGGATTCTCCACCGAGCTGTCC   TGTTGAGACGGATTCTCCACCGAGCTGTCC   GAGACGGATTCTCCACCGAGCTGTCCGATA   GAGACGGATTCTCCACCGAGCTGTCCGATA   GAGACGGATTCTCCACCGAGCTGTCCGATA   GATTCTCCACCGAGCTGTCCGATACGCCC   GATTCTCCACCGAGCTGTCCGATAGGCCC   TCTCCACCGAGCTGTCCGATACGCCCATG   CTCCACCGAGCTGTCCGATACGCCCATGA   CTCCACCGAGCTGTCCGATACGCCCATGA   TCCACCGAGCTGTCCGATACGCCCATGAA   TCCACCGAGCTGTGCGATACGCCCATGAA   REFERENCE  SEQUENCE   Coverage  
  16. 16. COMPARISON OF MICROARRAY-BASED ASSAYS AND NGS-BASED ASSAYS BioConference Live Genetics and Genomics 2013 TPCaruso & associates Pros and cons of each technology
  17. 17. Pros and cons of re-sequencing microarrays Pros •  Quick turn around time – 24-48 hrs •  Simple experimental protocol •  Once optimized rapid bioinformatic analysis •  Reports sequence at each tested locus unlike SNP arrays Cons •  Insertions and deletions are a problem •  Requires MPX PCR amplification for targets •  Noise is not consistent across the array •  Costly modifications to content •  Mutations can only be detected in tiled regions •  Problematic templates: –  Partly degraded DNA –  Whole genome amplified DNA BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  18. 18. Pros and cons of NGS Pros •  Detection of insertions and deletions •  Detection of novel mutations •  Better reproducibility •  Less incidental findings •  Continually decreasing pricing Cons •  Not full coverage in some areas •  More complex sample preparation •  Development of bioinformatic analysis is complex •  Sequence length can be an issue •  Risk of over- interpretation of results BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  19. 19. SUMMARY COMPARISON OF MICROARRAY- BASED ASSAYS AND NGS-BASED ASSAYS BioConference Live Genetics and Genomics 2013 TPCaruso & associates Feature Microarray NGS Development time Same as NGS – 50% Shorter – 50% Turn around time In majority cases shorter Reproducibility - 100% Data Analysis Data complexity Pipeline/report development More accidental findings More pathogenic mutations Higher confidence in data No difference – 50% Similar 50% Similar No Yes Yes Data Quality: Less “N” calls Substitutions detection Indels detection - Same Not adequate 100% Same or slightly better Better Cost effectiveness Varies Varies Validation Similar or slightly slower Similar or slightly quicker
  20. 20. BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  21. 21. Data Analysis/Reporting BioConference Live Genetics and Genomics 2013 TPCaruso & associates Sequence 1.  QC •  Experiment •  Obtained sequences •  Remove poor sequences 2.  Align to the reference genome 3.  Filter out known SNPs (non- pathogenic) 4.  Identify mutations 5.  Create a report •  Sample name •  Test name •  Laboratory QC metric •  List of mutations, zygosity •  Frequency of alleles Sample Report data view: 16bp deletion bp deletion visualized by aligning e p53 reference sequence. bp deletion visualized by aligning he p53 reference sequence. Fig. 7 . Heterozygous T>G mutation visualized by SeqNext by looking at the actual reads Fig.8. SeqNext can print a clinically relevant report
  22. 22. WHICH ONE TO CHOOSE THEN? Choice is based on a number of factors: 1.  Required throughput 2.  Nature of mutations 3.  Complexity of the assay to be performed 4.  Availability of equipment and expertise 5.  Time required for implementation of the assay BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  23. 23. ESTABLISHING TARGETED RE- SEQUENCING ASSAY IN THE LABORATORY 1.  Reasons for introduction 2.  Choice of platform 3.  In-house development or off the shelf product 4.  Validation – technical and clinical 5.  Implementation BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  24. 24. 1. Reasons for introducing a new assay •  Streamline the tests available – instead of 10s of tests just one •  Provide more comprehensive testing •  Meet the clinical needs of the customers •  Better performance, more accurate, more specific •  Competition already using gene panels •  Improve turn around time BioConference Live Genetics and Genomics 2013 TPCaruso & associates FASTER – BETTER - CHEAPER
  25. 25. BioConference Live Genetics and Genomics 2013 TPCaruso & associates Optimization of a test VALIDATION ASSAY PERFORMANCE QC PROFICIENCY TESTING DEVELOPMENT Platform Assay/Test IT/pipeline Patient testing IMPLEMENTATION Daily or when test is run Periodical•  Assay  content   •  OpUmizaUon  of  capture   or  amplificaUon   •  OpUmizaUon  of   sequencing  process   •  Technical  validaUon   •  Development  of  analysis  
  26. 26. Platform and assay source 2. Choice of platform NGS vs microarrays Type of NGS instrument Enrichment method 3. In-house development, off the shelf product or collaboration with another company Regulatory requirements Time and costs of assay development Time and costs of assay validation Availability of assay analytical performance documentation BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  27. 27. 4. Validation of a re-sequencing assay •  Definition of performance specifications –  Analytical sensitivity – likelihood of detecting sequence variation if present –  Analytical specificity – false +ve rate –  Reportable range – genes, exons, genomic regions –  Reference range – reportable sequence variations that can be detected –  Necessary coverage – to make accurate calls •  Establishment of QC process for the performance specs –  Coverage, quality scores, strand bias, GC bias, transition/transversion ratio, allelic read percentage •  Establishment of proficiency testing (PT) BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  28. 28. Reference materials – critical part of validation and on-going QC protocols •  gDNA (blood or cell lines) –  Blood (non-renewable) –  Cell lines (renewable) but can have genetic aberrations –  Similar to patient’s sample •  Synthetic –  Not representative of gDNA complexity •  Electronic reference materials –  Reference for analysis steps –  Data files might not be exchangeable between platforms BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  29. 29. Example of reference materials BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  30. 30. 5. Implementation •  Regulatory oversight –  FDA requirements – LDT vs cleared/approved tests –  CLIA regulations –  State requirements •  Guidance –  CDC –  Clinical Lab Standards Institute –  ACMG –  AMP –  CAP •  Proficiency testing and QC –  No formal programs exist for NGS –  QC has to include sample prep, library prep, generation of sequences, analysis of sequences and result reporting BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  31. 31. Implementation – Reporting guidance •  Constitutional mutations in genes (57) listed by ACMG on a minimum list – reported independently of the test indications •  Additional genes – might be analyzed for incidental findings (up to the lab) •  Incidental findings – report irrespective of the patient’s age •  Incidental findings – reported for a normal not tumor tissues BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  32. 32. Who is going to provide counseling to the patient? •  According to ACMG the ordering clinician or their team is responsible for providing the counseling •  A few points on this: –  Clinicians need to be familiar with NGS and its limitations –  Explain to the patients a possibility of incidental findings –  A clinical geneticist should be consulted regarding the ordering, interpretation and communication of the complex NGS assays. BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  33. 33. Summary •  Targeted sequencing allows sequencing of panels of genes for particular conditions •  Development and validation are complex –  Reference genome –  Reference templates –  Alternative tests for sequences with no or limited coverage •  Reporting requirements –  Combines QC of the assay and genetic data –  Simple yet comprehensive BioConference Live Genetics and Genomics 2013 TPCaruso & associates
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×