Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

  • 90 views
Uploaded on

Talk presented at the BioConference Live in 2010.

Talk presented at the BioConference Live in 2010.

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
90
On Slideshare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
1
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. TessArae, LLC, Proprietary Information Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens. Agnieszka M. Lichanska, Clark Tibbetts, and Matthew C. Lorence TessArae, LLC, Potomac Falls, Virginia, USA
  • 2. TessArae, LLC, Proprietary Information Overview   Re-sequencing technology vs. traditional diagnostic techniques   How does re-sequencing work?   How are the techniques different?   Identification of new pathogens - an example: novel H1N1 flu   Additional examples of use of RPM-Flu 3.1 assay   Summary
  • 3. TessArae, LLC, Proprietary Information Shift in Microbial Diagnostics TessArray™ ! TessArae Inc. TessArray RPM-Flu v3.1 Respiratory Pathogen Panel P/N: 520-191 Phenotypic detection and identification Genotypic detection and identification Mainly single result per test Multiple results per one test Multiple signatures per pathogen Detection and confirmation
  • 4. TessArae, LLC, Proprietary Information RPM Strategy GTATGGTAGTTGGGATAATTAGCTTGATGT CATACCATCAACCCTATTAATCGAACTACA GTATGGTAGTTGAGATAATTAGCTT GTATGGTAGTTGCGATAATTAGCTT GTATGGTAGTTGGGATAATTAGCTT GTATGGTAGTTGTGATAATTAGCTT CATACCATCAACACTATTAATCGAA CATACCATCAACCCTATTAATCGAA CATACCATCAACGCTATTAATCGAA CATACCATCAACTCTATTAATCGAA Probes to interrogate center position of first complementary target strand Probes to interrogate center position of second complementary target strand Target 25-base window of 8 transducers Hemagglutinin A/Goose/Guangdong/1/96/H5N1
  • 5. TessArae, LLC, Proprietary Information RPM Strategy GTATGGTAGTTGGGATAATTAGCTTGATGT CATACCATCAACCCTATTAATCGAACTACA GTATGGTAGTTGGAATAATTAGCTTG GTATGGTAGTTGGCATAATTAGCTTG GTATGGTAGTTGGGATAATTAGCTTG GTATGGTAGTTGGTATAATTAGCTTG CATACCATCAACCATATTAATCGAAC CATACCATCAACCCTATTAATCGAAC CATACCATCAACCGTATTAATCGAAC CATACCATCAACCTTATTAATCGAAC Hemagglutinin A/Goose/Guangdong/1/96/H5N1
  • 6. TessArae, LLC, Proprietary Information RPM Strategy GTATGGTAGTTGGGATAATTAGCTTGATGT CATACCATCAACCCTATTAATCGAACTACA GTATGGTAGTTGGGATAATTAGCTTGA GTATGGTAGTTGGGCTAATTAGCTTGA GTATGGTAGTTGGGGTAATTAGCTTGA GTATGGTAGTTGGGTTAATTAGCTTGA CATACCATCAACCCAATTAATCGAACT CATACCATCAACCCCATTAATCGAACT CATACCATCAACCCGATTAATCGAACT CATACCATCAACCCTATTAATCGAACT Hemagglutinin A/Goose/Guangdong/1/96/H5N1
  • 7. TessArae, LLC, Proprietary Information TessArray® RPM-Flu 3.1 TessArray™ ! TessArae, LLC TessArray RPM-Flu v3.1 Respiratory Pathogen Panel P/N: 520-191 Coronavirus (229E) Coronavirus (OC43) Coronavirus (NL63) Coronavirus (SARS Urbani) Cytomegalovirus (HHV-5) Enteroviruses: •  Coxsackievirus (5 types) •  Echovirus (8 types) •  Rhinovirus (27 types) Measles Virus Metapneumovirus (types A, B) Parainfluenza 1 Parainfluenza 2 Parainfluenza 3 Parainfluenza 4a Parainfluenza 4b RSV A RSV B Rubella Virus Bordatella pertussis Corynebacterium diphtheriae Chlamydia psittaci Chlamydia trachomatis Chlamydophila pneumoniae Haemophilus influenzae Klebsiella pneumoniae Legionella pneumophila Moraxella catarrhalis Mycobacterium kansasii Mycobacterium tuberculosis Mycoplasma pneumoniae Neisseria meningitidis Pseudomonas aeruginosa Staphylococcus aureus Streptococcus agalactiae Streptococcus pneumoniae Streptococcus pyogenes Variola major Bacillus anthracis Francisella tularensis Yersinia pestis Influenza A HA1 Influenza A HA2 Influenza A HA3 Influenza A HA4 Influenza A HA5 Influenza A HA6 Influenza A HA7 Influenza A HA8 Influenza A HA9 Influenza A HA10 Influenza A HA11 Influenza A HA12 Influenza A HA13 Influenza A HA14 Influenza A HA15 Influenza A HA16 Influenza A NA1 Influenza A NA2 Influenza A NA3 Influenza A NA4 Influenza A NA5 Influenza A NA6 Influenza A NA7 Influenza A NA8 Influenza A NA9 Influenza A Mtx Influenza A NS Influenza A PB2 Influenza B HA1 Influenza B HA2 Influenza B NA1 Influenza B Mtx Adenovirus B Adenovirus C Adenovirus D Adenovirus E Simultaneous differential diagnosis of influenza-like illness 30 different types of viral and bacterial respiratory pathogens 938,032 oligonucleotide probes 117,254 nucleotides of targeted pathogen gene sequences per assay
  • 8. TessArae, LLC, Proprietary Information How the RPM Assay Works?   Control Template Live Influenza Vaccine (FluMist® 2004-2005)   Trivalent mixture of different influenza virus A/HN and B subtypes   A/Canterbury/20/1999 (H1N1)   A/Wyoming/3/2003 (H3N2)   B/Jilin/20/2003   Hemagglutinin and Neuraminidase Genes from these Vaccine Strains   Engineered by Reassortment with Cold-Adapted Master Strains   A/Ann Arbor/6/1960 (H2N2)   B/Ann Arbor/1/1966   Matrix and Other Viral Genes from Master Strains
  • 9. TessArae, LLC, Proprietary Information Chip Background Segment Tile AGT C C AG T Translation Key: TGGAAAATGAAAGGACTTTGGATTTCCATGACTCCAATGTGAAGA! Influenza A Virus segment 4 hemagglutinin (HA1)
  • 10. TessArae, LLC, Proprietary Information >EV70UTR:NRL_KB_FluVaccine_082206 Start=12 End=707! nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn! nnnnnnnnnnnnnnnnnnnnnnnnnnnncnannnnnngnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn! nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnng! nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn! nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnncnnngnnnnnnnnnnnnn! nnnnnnnnnnnnnnnnnnnnnnnnngnnnnntnnnnnnnnnnnnnnnncncnnnnnnnnnncnnnnnnnnnnnnnnnnnt! nnnnnnnnnnntnngancnnnnngnnnnnnnnnnccnnnngnnnnnnnnnnnnnnnnnnggnnnnnnnnnnnncnnnnnn! nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnacnnnnnnnnn! nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnn! >FLUAHA1:NRL_KB_FluVaccine_082206 Start=12 End=1487! agaagaatgtgacagngncncactctgtcaacctacttgaggacagtcacaatggaaaactatgtctactaaaaggaata! gccccncnnnnnntgggtaattgcagcgttgccggatggatcttaggaaacccagaatgcgaattactgatttccaagga! atcatggtcctacattgtagaaacaccaaatcctgagaatggaacatgttacccagggtatttcgccgactatgaggaac! tgagggagcaattgagttcagtatcttcatttgagagattcgaaatattccccaaagaaagctcatggcccaaccacacc! gtaaccggagtatcagcatcatgcncccnnnnngggaaaagcagtttttacagaaatttgctatggcngncnnnnnngaa! tggnnnnnnnccaaacctgagcaagtcctatgtaaacaacaaagagaaagaagtccttgtactatgggcnntncntcacc! cgcctaacanagggaaccaaagggccctctatcatacagaaaatgcttatgtctctgtagtgtcttcacattatagcaga! agattcaccccagaaatagccaaaagacccaaagtaagagatcaggaaggaagaatcaactactactggactctgcngga! acctggggatacaataatatttgaggcaaatggaaatctaatagcgccatggtatgcttttgcactgagtagaggctttg! gatcaggaatcatcacctcaaatgcaccaatggatgaatgtgatgcgaagtgtcaaacacctcagggagctataaacagc! agtcttcctttccagaatgtacacccagtcacaataggagagtgtccaaagtatgtcaggagtgcaaaatnaaggatggn! tacaggactaaggaacatcccntccattcaatccagaggtttgtttggagccattgccggtttcattgaagnnnngtgga! ctggaatggtagatgggtggtatggttatcatcatcagaatgagcaaggatcnggnnnnnnnncagatcaaaaaagtnca! caaaatgccattaacgggattacaaacaaggtgannnnnnnnnnnnagaaaatgaacactcaattcacngcngtgggcaa! agaattcaacaaattggaaagaaggatggaaaacttaaataaaaaagttgatgatgggtttctagacatttggannnnnn! nnncagaattgttggttctacTGGAAAATGAAAGGACTTTGGATTTCCATGACTCCAATGTGAAGAatctgtatgagaaa! gtaaaaagccaattaaagaataatgccaaagaaataggaaacgggtgttttgaattctatcacaagtgtaacaatgaatg! catggagagtgtgaaaaatggaacttatgactatccaaaatattccgaagaatcaaagttaaacagggagaaaattgatg! gagtgaaattggaatcaatgggagtctatcagattc! >FLUAHA10:NRL_KB_FluVaccine_082206 Start=12 End=787! nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnngnnnnn! nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn! nnnnnnnnnnnnnnnnnnnnnnnnngnnnnncnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnn! nnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn! nnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn! nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn! nnnnnnnnnnnnnnnnnnnnnnannnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnn! nnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn! nnnnnnncaggaangagnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn! nggnnnnnntnnnangnaggnnggnngnnnnnnnnnnnnnnnnnnncnnnnnnnnn… Enterovirus 70 UTR Negative Type A Flu - HA1 Positive Type A Flu - HA10 Negative
  • 11. TessArae, LLC, Proprietary Information How to Identify a Novel Pathogen?
  • 12. TessArae, LLC, Proprietary Information RPM Detection of Novel Strains CATACCATCAACCCTATTAATCGAACTACAGC GTATGGTAGTTGGGATAATTAGCTTGATGTCG TGGTAGTTGGGAAAATTAGCTTGAT TGGTAGTTGGGACAATTAGCTTGAT TGGTAGTTGGGAGAATTAGCTTGAT TGGTAGTTGGGATAATTAGCTTGAT ACCATCAACCCTATTAATCGAACTA ACCATCAACCCTCTTAATCGAACTA ACCATCAACCCTGTTAATCGAACTA ACCATCAACCCTTTTAATCGAACTA CATACCATCAACCCTGTTAATCGAACTACAGC GTATGGTAGTTGGGACAATTAGCTTGATGTCG TGGTAGTTGGGAAAATTAGCTTGAT TGGTAGTTGGGACAATTAGCTTGAT TGGTAGTTGGGAGAATTAGCTTGAT TGGTAGTTGGGATAATTAGCTTGAT ACCATCAACCCTATTAATCGAACTA ACCATCAACCCTCTTAATCGAACTA ACCATCAACCCTGTTAATCGAACTA ACCATCAACCCTTTTAATCGAACTA Forward strand sequence variant detection Reverse strand sequence variant detection target Old Strain New Strain
  • 13. TessArae, LLC, Proprietary Information Detection of Novel Strains
  • 14. TessArae, LLC, Proprietary Information Novel H1N1 Influenza Detection
  • 15. TessArae, LLC, Proprietary Information Detecting Seasonal Strains of Influenza RPM-Detector Tiles for Seasonal A/H1N1 and Seasonal A/H3N2 Influenza Viruse s Vir u s Target Gen e Detector Tile Sequence/Strai n Leng t h Prob e s A/H1 N 1 Hemagglutinin(A/HA1 ) A/New Caledonia/20/1999(H1N1) 1500 bp 12,000 A/H1 N 1 Neuraminidase(A/NA1) A/New Caledonia/20/1999(H1N1) 1200 bp 9,600 A/H1 N 1 Matrix(A/H1N1-M ) A/Canterbury/100/2000(H1N1) 850 bp 6,800 A/H3 N 2 Hemagglutinin(A/HA3 ) A/Canterbury /125/2005(H3N2) 1500 bp 12,000 A/H3 N 2 Neuraminidase(A/NA2) A/Canterbury /125/2005(H3N2) 1200 bp 9,600 A/H3 N 2 Matrix(A/H3N2-M ) A/Canterbury /125/2005(H3N2) 850 bp 6,800
  • 16. TessArae, LLC, Proprietary Information A Sentinel Case April 2009:  Patient presents at Washington, DC hospital  Recently returned from vacation in Mexico  Convalescing from recent flu-like illness  Anxious about reports of novel influenza outbreak TessArray Outcomes: 01 May 2009 - Best Matches L20309, X90504 H influenzae outer membrane protein P5 A/duck/Guanxi/2004(H5N1); A/chicken/Yogjakarta/2004(H5N1) Very unusual result suggested patient had been infected by an avian influenza virus Database updated following week, new sequence records from Mexico outbreak isolates 05 May 2009 - Best Matches L20309, X90504 H influenzae outer membrane protein P5 A/California/07/2009(H1N1); A/Texas/04/2009(H1N1) Perfect Match to New CDC Strain! From a Test Designed in 2006 With No Prior Knowledge of New Strain
  • 17. TessArae, LLC, Proprietary Information T S R A - A ML_CNMC_01_050109 (“RPM-Flu Sentinel Case”) Best Matches from VSRD Archive Updated November 2008 Best Matches from VSRD Archive Updated May 2009 A/chicken/Indonesia/7/2003(H5N1) A/chicken/Puebla/231-5284/98(H5N2) A/chicken/Puebla/231-5284/98 (H5N2) A/chicken/Yogjakarta/BBVet-IX/2004(H5N1) A/duck/Guangxi/1436/2006(H5N1) A/duck/Guangxi/351/2004(H5N1) A/duck/Guangxi/3548/2005(H5N1) A/duck/Guangxi/380/2004(H5N1) A/duck/Guangxi/4016/2005(H5N1) A/hooded vulture/Burkina Faso/2/2006(H5N1) A/mallard/Alberta/111/99(H4N6) A/mallard/Alberta/111/99(H4N6) A/mallard/Maryland/1235/2006(H3N6) A/mallard/Maryland/1235/2006(H3N6) A/quail/Tasikmalaya/BPPV4/2004(H5N1) A/swine/Hong Kong/1197/02(H3N2) A/swine/Hong Kong/1197/02(H3N2) A/swine/Iowa/930/01(H1N2) A/swine/Virginia/670/1987(H1N1) A/swine/Virginia/671/1987(H1N1) A/swine/British Columbia/28103/2005(H3N2) A/California/04/2009(H1N1) A/California/05/2009(H1N1) A/California/06/2009(H1N1) A/California/07/2009(H1N1) A/California/08/2009(H1N1) A/California/09/2009(H1N1) A/California/10/2009(H1N1) A/California/14/2009(H1N1) A/Canada-ON/RV1527/2009(H1N1) A/New York/06/2009(H1N1) A/New York/10/2009(H1N1) A/New York/11/2009(H1N1) A/New York/15/2009(H1N1) A/New York/18/2009(H1N1) A/New York/19/2009(H1N1) A/New York/20/2009(H1N1) A/New York/22/2009(H1N1) A/Ohio/07/2009(H1N1) A/Texas/04/2009(H1N1) A/Texas/05/2009(H1N1) RPM detection and identification works for strains and variants that share at least 80% sequence similarity to array detector tiles The RPM-Flu 3.1 designed for A/H5N1 in 2006 is capable to sensitively detect and differentiate the Novel A/H1N1 SOIV from Seasonal A/H1N1 and Seasonal A/H3N2 subtypes without modification 190/215 = 88%
  • 18. TessArae, LLC, Proprietary Information Avian A/H5N1 matrix gene resequencing detector tile sequence (top sequence) 2009 Novel H1N1 (A/ Pensacola/INS107/2009 (H1N1)) strain (middle sequence) Sequence from a high titer stock of a 2009 Novel H1N1 outbreak strain strain, A/ NHRC-California/BRD_40116 (H1N1) (bottom sequence) Legend: x = Mismatch | = Match
  • 19. TessArae, LLC, Proprietary Information Seasonal H1N1 Seasonal H3N2 Novel H1N1 LoD (95%) TCID50/ml TessArray RPM-Flu  Novel A/H1N1 1,740  Seasonal A/H1N1 102  Seasonal A/H3N2 224 CDC rRT-PCR (JBAIDS)  Novel A/H1N1 5,000  Seasonal A/H1N1 10  Seasonal A/H3N2 100 Analytical Sensitivity with Cultured Influenza Virus
  • 20. TessArae, LLC, Proprietary Information Analytical Sensitivity Cultured Influenza Virus Controls Seasonal A/H1N1 Seasonal A/H3N2 2009 Novel A/H1N1 SOIV Endpoint LoD Titration Seasonal A/H1N1 38/38 (100%) 0/41 (0%) 0/41 (0%) Seasonal A/H3N2 0/58 (0%) 44/44 (100%) 0/58 (0%) 2009 Novel A/H1N1(SOIV) 0/55 (0%) 0/55 (0%) 44/44 (100%) Positive Clinical Specimens Seasonal A/H1N1 13/13 (100%) 0/13 (0%) 0/13 (0%) Seasonal A/H3N2 0/31 (0%) 31/31 (100%) 0/31 (0%) 2009 Novel A/H1N1(SOIV) 0/8 (0%) 0/8 (0%) 8/8 (100%) Negative Controls Avian A/H5N1-positive 0/16 (0%) 0/16 (0%) 0/16 (0%) Other High Load Pathogens 0/24 (0%) 0/24 (0%) 0/24 (0%) Water Blanks 0/14 (0%) 0/14 (0%) 0/14 (0%) Clinical Negative by PCR 0/501 (0%) 0/501 (0%) 0/501 (0%)
  • 21. TessArae, LLC, Proprietary Information Detecting Emergent Strains A/New Caledonia/20/1999(H1N1) Hemagglutinin A/New Caledonia/20/1999(H1N1) Neuraminidase A/Canterbury/100/2000(H1N1) Matrix A/Canterbury/125/2005 (H3N2) Hemagglutinin A/Canterbury/125/2005 (H3N2) Neuraminidase A/Canterbury/125/2005 (H3N2) Matrix 2004-5 FluMist  A/New Caledonia/20/1999(H1N1)  A/New Caledonia/20/1999(H1N1)  A/Ann Arbor/6/1960(H2N2)  A/Wyoming/03/2003 (H3N2)  A/Wyoming/03/2003 (H3N2)  A/Ann Arbor/6/1960(H2N2) 2009-10 FluMist A/South Dakota/6/2007(H1N1) A/South Dakota/6/2007(H1N1) A/Ann Arbor/6/1960(H2N2) A/Uruguay/716/2007 (H3N2) A/Uruguay/716/2007 (H3N2) A/Ann Arbor/6/1960(H2N2) What s on the Device: What it Told Us: TessArray™ ! TessArae, LLC TessArray RPM-Flu v3.1 Respiratory Pathogen Panel P/N: 520-191 2006-7 FluZone A/New Caledonia/20/1999(H1N1) A/New Caledonia/20/1999(H1N1) A/Puerto Rico/8/1934(H1N1) A/Wisconsin/67/2005 (H3N2) A/Wisconsin/67/2005 (H3N2) A/Puerto Rico/8/1934(H1N1) 2009-10 FluVirin A/South Dakota/6/2007(H1N1) A/South Dakota/6/2007(H1N1) A/Puerto Rico/8/1934(H1N1) A/Uruguay/716/2007 (H3N2) A/Uruguay/716/2007 (H3N2) A/Puerto Rico/8/1934(H1N1) When Confronted With Different Strains the Array Still Tells Us What Is Present Based on the Sequences of the Organisms
  • 22. TessArae, LLC, Proprietary Information Match SEPRL Reference Strain H1N1 A/Turkey/Kansas/4880/80 H2N8 A/Herring Gull/DE/677/88 H3N2 A/turkey/MN/366767/2005 H4N6 A/Blue Winged Teal/LA/240B/88 H7N2 A/quail/PA/20304/98 H8N4 A/turkey/CO/169118-13/02 H10N7 A/quail/NJ/25254-22/95 H11N3 A/chicken/NJ/4645/96 H12N5 A/duck/LA/188D/87 H13N6 A/gull/MD/1824/78 AMPV, No AI Avian Metapneumovirus (Colorado Strain) H5N3 A/duck/Singapore/F119/97 H7N3 A/chicken/Chile(F0)/176822/02 No AI Avian Paramyxovirus I (NDV, RPM-TEI assay) H5N2 A/chicken/Mex/26654-1374/94 H7N1 A/turkey/Italy/4580/99 H7N3 A/chicken/Pakistan/1369-CR2/95 H7N7 A/chicken/Victoria/85 H14N5 A/mallard/Gurjev/263/82 H15N9 A/Shearwater/W. Australia/2576/79 Sample RPM Assay 1 H1N1 2 H2N8 3 H3N2 4 H4N6 6 H7N2 7 H8N4 9 H10N7 10 H11N3 11 H12N5 12 H13N6 13 AMPV, No AI 14 H5N3 15 H7N3 16 No AI 17 H5N2 18 H7N1 19 H7N3 20 H7N7 21 H14N5 22 H15N9 Specimens from USDA ARS SEPRL reference archive (20 Mar 08) Avian Influenza Subtypes: Differential Diagnostics
  • 23. TessArae, LLC, Proprietary Information Reconciliation of Inter-Platform Results Discrepancies by de novo DNA Sequencing of Viral Genes from Original Specimens Sample ID CDC-Certified H5 (Asian) PCR Ibis-T5000 ESI-MS HA RSLT (P1) Serology TessArray® RPM-Flu v3.1 Gold Standard DNA Sequencing 2006900845 H5 H5N1 H5 H5N1 not tested 2006906089 H5 H5N1 H5 H5N1 not tested 2006900590 H5 H5N1 H5 H5N1 not tested 2006902838 H5 H5N1 H5 H5N1 not tested 2006902764 not tested H5N1 H5 H5N1 H5N1 2006905588 Flu UNKNOWN H7 H7N7 H7N7 2004909864 not tested H9N2 UNKNOWN H7N7 H7 2005912823 Flu H7N7 UNKNOWN H10N7 H10N7 2005912908 not tested H7N7 H10 H10N7 H10N7 2004900600 Flu H7N7 H10 H10N7 H10N7 2004900845 H5 H5N1 H10 H10N7 or H10N5 H10N7 2004900688 not tested H7N7 H11 H11N? H11 2005912306 Flu NEW UNKNOWN H13N6 or H13N8 H13 = Conflict with de novo sequencing results Avian Influenza Subtypes: Differential Diagnostics = Results concordant with de novo sequencing Lin et al PLOS 2009
  • 24. TessArae, LLC, Proprietary Information Longitudinal Data Analysis CT_Sick_050509 Rhinovirus CT_Sick_042010 Parainfluenza Virus CT_Healthy_Control_080508 CT_Sick_Day4_080603 Metapneumovirus But not the novel A/H1N1!
  • 25. TessArae, LLC, Proprietary Information MLST-like Epidemiological Analysis: Genomic diversity of Haemophilus influenzae from 50 Different Patients at MCRD San Diego
  • 26. TessArae, LLC, Proprietary Information MLST-Like Epidemiological Analysis: Clonal genomic uniformity of Adenovirus Type 4 in Same 50 Patients at MCRD San Diego
  • 27. TessArae, LLC, Proprietary Information Summary   Real-time Epidemic/Pandemic Surveillance in Human and Animal Populations   Simultaneous Detection and Definitive Identification of Multiple Pathogens   Characterization of Difficult Cases   Superior to Benchmark Platform Sensitivity and Specificity   Limits of Detection ~ 102 Genome Equivalents/specimen   Zero False Positive Detection Events   Immediate Identification of Known and Unknown Strains and Variants   Surveillance of Shift and Drift in Populations   Same Day Results   RPM Sequence-based Detector Array   Six Sigma Data Quality   Basecall Error Rate ≥ 10-6
  • 28. TessArae, LLC, Proprietary Information Acknowledgements Naval Health Research Center/Naval Respiratory Disease Laboratory, San Diego, CA David Metzgar Chris Myers Christian Hansen CDR Kevin Russell Jason Brown Larivhie Dela Cruz CDR Dennis Faix Miguel Osuna David Ortiz TessArae, LLC - Potomac Falls, VA Clark Tibbetts Brian Weslowski Leah Morris Matthew Lorence Lisa Borsuk Klaus Schafer Naval Research Laboratory/Center for Bio/Molecular Science and Engineering - Washington, DC Joel Schnur Anthony Malanoski Nina Long David Stenger Baochuan Lin Carolyn Kidd Zheng Wang Dzung Thach Kate Blaney