Replicacao e transcriçao DNA procariotos
Upcoming SlideShare
Loading in...5
×
 

Replicacao e transcriçao DNA procariotos

on

  • 25,214 views

 

Statistics

Views

Total Views
25,214
Views on SlideShare
25,214
Embed Views
0

Actions

Likes
3
Downloads
248
Comments
4

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel

14 of 4 Post a comment

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
  • Obrigada pessoal...como sempre digo preparar aulas é algo pessoal, cada um tem que preparar a suas, ter outras aulas que nos auxiliam na montagem e sequencia de infromações, em esquemas e imagens, mas sem o conhecimento de nada serve!!
    Are you sure you want to
    Your message goes here
    Processing…
  • Fiquei confusa com algumas coisas.
    Are you sure you want to
    Your message goes here
    Processing…
  • Prof. Doutora Adriana, parabenizo-a pelo excelente trabalho!
    Are you sure you want to
    Your message goes here
    Processing…
  • MUITO BOM !!
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Replicacao e transcriçao DNA procariotos Replicacao e transcriçao DNA procariotos Presentation Transcript

    • Prof. Dra. Adriana DantasUERGS – Bento Gonçalves
    • • Watson e Crick propuseram, em 1953, um modelo de molécula de DNA, que seria em DUPLA DNA HÉLICE e em ESPIRAL, com duas cadeias de nucleotídeos ligados por PONTES DE HIDROGÊNIO.
    • Informações disponíveis, quais eram:1- a molécula de DNA era grande, longa, fina e composta de nucleotídeos: adenina; guanina; timina e citosina;2- Os estudos de difração de raios X, realizados por Maurice King e Rosalind Franklin sugeriam a forma helicoidal;3- Linus Pauling (1950), descreveu a estrutura helicoidal com um filamento mantida por pontes de hidrogênio em proteínas e sugeriu que o mesmo pudesse ocorrer com o DNA;4- Erwin Chargaff havia demonstrado que a proporção entre os nucleotídeos A e T era de 1:1, o mesmo acontecendo entre G e C.
    • Difração de Raios-X Estrutura Molecular 34A
    • O ÁcidoDesoxirribonucléico é umpolinucleotídeo formadopor duas “fitas” ou hélicesligadas entre si por pontesde hidrogênio entre as basesnitrogenadas.O pareamento das basessempre segue a mesmaordem: Adenina com Timinae Guanina com Citosina.
    • Polímero longo: Base 1 1. A ligação entre a base Pentose nitrogenada e a pentose é feita covalentemente através de uma ligação N-glicosídica com a hidroxila ligada ao carbono-1 da pentose.4 1 22 •2. Os nucleotídeos são unidos por ligações fosfodiéster covalentes que ligar o carbono 5´de um grupo desoxirribose (pentose + base) ao carbono 3´do próximo
    • Portanto: : 1) ÁCIDOS NUCLEICOS são compostos por nucleotídeos ligados entre si através de ligação covalente. 2) NUCLEOTÍDEOS são as unidades fundamentais dos ácidos nucléicos. Cada nucleotídeo é constituído por um grupo fosfato, uma pentose e uma base. Purinas: Adenina, Guanina BASESDNA ≠ RNA Pirimidinas: Citosina, Timina, Uracila
    • Adenina Guanina PurinasCitosina Timina Uracil Pirimidinas
    • A Importância do DNA-Transportar muita informação, de célula para célula e de geraçãopara geração;-Capacidade de produzir cópias exatas de si mesmo, pois oscromossomos são copiados em cada divisão celular;-Capacidade de “replicar erros” de cópia, como se fossem o geneoriginal;-Apresenta mecanismo de decodificação da informaçãoarmazenada, traduzindo-as através da produção deenzimas/proteínas;-O DNA é chamado de “molécula da vida” pois contém o códigopra construção das proteínas em todos os seres vivos;-Nos eucariontes, o DNA é encontrado no núcleo celular formandoos cromossomos e também nas mitocôndrias e nos cloroplastos;-Nos procariontes encontra-se uma molécula de DNA circular(cromossomo bacteriano) e outras moléculas circulares chamadasplasmídeos;
    • As seqüências ose-fosfato sãorepresentadas pelaslinhas, e as seqüênciasde pares de bases éaleatória
    •  Se replicação é semi-conservativa e a polimerização deve ser sempre no sentido 5 ´→3´ Mas o DNA é antiparalelo ou seja, uma fita ocorre no sentido 5’ → 3’ e a outra no sentido 3’ → 5’ Como ocorre então a replicação nos dois sentidos?
    •  A dupla hélice é como um zíper que se abre, começando por uma ponta, a deselicoidizaçao dos dois filamentos irá expor as bases isoladas de cada filamento. Cada base exposta irá se parear apenas com sua base complementar; Um dos filamentos isolados irá agir como molde e começará a formar uma dupla hélice idêntica a que foi aberta; Os nucleotídeos será adicionados supostamente vem de reservatório livre presentes na células
    • Replicação do DNAO mecanismo dereplicação estábaseado nopareamento dasbases da duplahélice do DNA.A estrutura doDNA contém ainformaçãonecessária paraperpetuar suaseqüência debases
    • Origens de replicação A replicação da E. coli começa a partir de uma origem fixa, progride bi-direcionalmente A forquilha se move em ambas as partes, terminando num local chamado término A origem única é chamada oriC , tem 245 pb de comprimento; Seqüência em tandem com 13 pb, chamada seqüência de consenso; Seqüência de pontos de ligação com uma proteína, onde
    • OriC -cromossomode E.coli
    • Nos eucariotos são abertos várias "bolhasde replicação" ou replicons
    •  Autoradiografias feitas por J. Cairns (1963) em DNA de E. coli tratadas com meio contendo Trimidina comprovaram que a replicação é semi-conservativa, bidirecional e que o DNA e circular.
    • A replicação do cromossomo circular
    • Replicon: Unidade do DNA onde está ocorrendo umevento de replicaçãoReplicon:• Origem + Término• Ativados apenas uma única vez em cada ciclo celular• O genoma de uma célula procariótica constitui um único replicon• Cada cromossomo eucariótico constitui vários replicons e todos são ativados uma única vez no ciclo celular ainda que não simultaneamente
    • O genoma bacteriano circular constitui um único replicon Origem da replicação Forquilhas de replicação Fitas novas Fitas velhas• A velocidade da forquillha de replicação bacteriana é 50000pb/min• Um única origem de replicação em E.coli (OriC, 245 pb)
    • O genoma eucariótico constitui vários replicons A velocidade da forquillha de replicação eucariótica é 2000pb/min Os replicons eucarióticos tem 40-100 kb e são iniciados emtempos diferentes Fase S demora ~ 6hrs em uma célula somática
    •  A síntese de DNA deve ser iniciada com um primer, oligonucleotideos curtos, que gera um segmento de DNA duplex; A replicação de cromossomos de E. coli usa primers de RNA, são sintetizados ou pela RNA polimerase ou pela enzima primase; Primase sintetiza um trecho curto (aproximadamente 30 pb) de RNA complementar a uma região especifica do cromossomo; A Cadeia de RNA é então amplificada com DNA pela DNA polimerase
    •  A primase de E. coli forma um complexo com o molde de DNA e proteínas adicionais, com dnaB, dnaT, priB e priC. O complexo total é chamado de primossomo; DNA polimerase sintetizam novas cadeias no sentido 5’- 3’; Devido a polaridade inversa da molécula de DNA, movem-se no sentido 3’- 5’no filamento molde; Enquanto o filamento leading(novo) é sintetizado continuamente, o lagging é sintetizado em segmentos curtos e descontínuos
    •  O novo filamento cresce em sentido oposto da forquilha de replicação Em E.coli a poli III faz a maior parte da síntese do DNA em ambos os filamentos, a poli I completa os espaço deixados no filamento lagging, que então são fechados pela DNA ligase Fita contínua (líder) Fita descontínua
    • Polimerases de DNA:As enzimas quesintetizam DNA A síntese de DNA ocorrepela adição de nucleotídeosa extremidade 3´OH dacadeia em crescimento. O precursor da síntese éo desoxiribonucleosídeo 5´trifosfato Sentido da síntesesempre é 5’ → 3’ A replicação é umprocesso extremamente fiel. As DNA-polimerases tematividade revisora
    • DNA polimerase•A DNA polimerase estendem a cadeia,(polimerização) mas não podem iniciar a polimerizaçãocadeia•DNA polimerase - enzima que catalisa areação de replicação•Reação funciona com as formas detrifosfato dos nucleotídeos•Quantidade total de DNA ao final dareação pode ser de até 20 vezes aquantidade original de DNA.
    • As enzimas e suas ações Polimerases: todas podem tanto adicionar como remover nucleotídeos, somente no sentido 5’ → 3’; Quando removem do final do filamento são chamadas de exonucleases Se os removem em algum outro lugar do filamento, são chamadas de endonucleases . A remoção é feita no sentido inverso, ou seja 3’ → 5’.
    • Desoxiribonucleosídeo 5´trifosfato (precursor)Fita sendopolimerizadaFita molde
    • As DNA-polimerases sempre requerem um iniciadorpreviamente pareado ao molde que será copiado
    • Atividade revisora 3’ → 5’ garante a fidelidade da replicação
    • Tipo FunçãoDNA Polimerase I Catalisa o crescimento da cadeia no sentido 5´3´ Atividade de exonuclease 3´5´ e 5´3´ Preenche pedaços pequenos de DNA durante a replicação e processo de reparoDNA Polimerase II Polimerase alternativa de reparo, mas também pode replicar DNA quando o filamento molde é danificadoDNA Polimerase III Catalisa o crescimento da cadeia no sentido 5 ´3´. É a polimerase primária durante a replicação normal do DNA
    •  Helicases são enzimas que rompem pontes de hidrogênio que unem os dois filamentos de DNA na dupla hélice; Entre as helicases de E.coli estão a proteína dnaB e rep; Gera torções no DNA circular que tem que ser removidas para permitir que a replicação continue; A superelicoidizaçao pode ser criada ou relaxada por enzimas chamadas topoisomerases; As topoisomerases podem induzir ou remover alças, ou ligações em uma cadeia.
    •  Proteínas de iniciação identificam a origem da replicação e participam da ligação da DNA helicase ao DNA; A proteína de iniciação acoplada à DNA helicase abre o DNA na junção “Y”. As pontes de H se rompem e a molécula se abre como um zíper e se desespiraliza e a ela unem-se a primase e outras proteínas (DNA helicase + primase + outras proteínas = primossomo) As fitas se mantêm separadas durante a replicação graças à ação de uma proteína a Single-strand binding proteins - SSB
    •  A primase (que é uma RNA-polimerase) constrói o primer de RNA em uma região não coberta pelas SSB; A topo isomerase alivia a tensão da espiralização provocada pela abertura do DNA Ex. DNA girase; A DNA polimerase (III) sintetiza as novas cadeias. Capturam os nucleotídeos, prontos com um trifosfato, os levam ao molde, retiram dois fosfatos e os ligam ao C 3’ do nucleotídeo anterior. A polimerização ocorre muito rapidamente (100.000 nucl./min). nucl./min) Outras DNA polimerases preenchem as falhas e corrigem erros.
    •  Os Fragmentos de Okazaki (complementam o filamento lagging); É formado um primer de RNA pela enzima primase; Os primers são continuados pela DNA polimerase III até o primer do próximo fragmento de Okasaki; DNA polimerase I retira o primer de RNA e completa o pedaço com nucleotídeos corretos; Os fragmentos são ligados pelas DNA ligases.
    •  Duas DNA polimerases III ficam unidas e trabalham conjuntamente, a helicase e a primase movem-se ao longo do DNA; O filamento leading é alimentado imediatamente pela polimerase; O filamento lagging não é complementado pela polimerase até que um primer seja colocado sobre o filamento.; Isto significa: que um longo pedaço de DNA fica aberto significa durante o processo e que a replicação que ocorre primeiro no filamento leading enquanto a do filamento
    • A subunidadeBeta daDNA-polimeraseIII envolve oduplex dasfitas-filhas
    • Proteínas presentes na origem de Replicação de E.coliDnaA Reconhece a origem e abre a dupla fita em sítios específicosDnaB (helicase) Desenrola o DNADnaC Auxilia a ligação de DnaB na origemHU Proteína do tipo histona que estimula a iniciaçãoPrimase (DnaG) Sintetiza os primers de RNASingle strand binding Liga a fita simples de DNA(SSB)RNA polimerase Facilita a ação da DnaADNA girase Alivia a tensão torsional gerada pela abertura da dupla-fitaDam Metilase Metila as sequências GATC na OriC
    • A síntese do DNA é semi-descontínua e requer um iniciador (primer) de RNA Síntese da Fita descontínua Fita descontínua Fita contínua Síntese da Fita Contínua
    • Fragmentosde Okasakiocorrem na fitadescontínua A DNApolimerase IIIé responsávelpela síntese damaior parte doDNA A DNApolimerase Iremove oprimer de RNAe preenche aslacunas A DNAligase sela asquebras
    • A DNA ligase sela as quebras
    • Proteínas presentes na forquilha de Replicação de E.coliSSB Liga a fita simples de DNADnaB (helicase) Desenrola o DNAPrimase (DnaG) Sintetiza os primers de RNADNA Polimerase III Sintese da fita novaDNA Polimerase I Preenche as lacunas e excisa os primersDNA Ligase Liga os fragmentosDNA girase Superenrolamento
    • O complexo dereplicação A proteína DNA B(helicase) é responsávelpelo movimento parafrente da forquilha Cada core catalíticoda DNA PolIII sintetizauma das fitas-filhas O primossomo afastauma das fitas molde Proteínas SSBmantem as fitasparentais separadas
    • Forquilha Forquilhasentido sentidoantihorário horário Terminação Terminação
    •  A replicaçao do DNA de bacterias como a E. coli, segue bidirecionalmente ao redor do cromossomo. Duas forquilhas de replicação movem-se em direções opostas, para longe da origem de replicação Como cromossomo bacteriano é um alça fechada, as forquilhas de replicação acabam se encontrando quando a replicação esta completa Após a replicação cada célula filha recebe uma copia da molécula nova de DBA, isto é – um cromossomo completo.
    • DNA Polimerase em FunçãoeucariotosDNA Polimerase α Replicação do cromossomo nuclear (fita lagging)DNA Polimerase β Reparo de DNA no preenchimento de espaços do cromossomo nuclear. Análoga a Polimerase IDNA Polimerase γ Replicação de DNA mitocondrialDNA Polimerase δ Replicação do filamento leader a da lagging do cromossomo nuclearDNA Polimerase ε Reparo do DNA do cromossomo nuclearDNA Polimerase ζ Aparentemente reparo de DNA
    •  Nos fragmentos de Okasaky, os primers de RNA são removidos por uma Rnase que é complementado por uma polimerase de reparo. A finalização da replicação é feita com a formação de estruturas complexas no topo do cromossomo, os telômeros Os telômeros são replicados com a ajuda das telomerases.
    • voltar
    • TRANSCRIÇÃO : EUCARIOTO X PROCARIOTOEUCARIOTOS PROCARIOTOS
    •  Fita complementar de RNA a partir de uma DNA TRÊS tipos de RNA em procariotos:  RNA mensageiro – codifica a informação  RNA ribossômico – maquina para síntese protéica  RNA de transferência
    •  RNA polimerase liga-se ao DNA em local denominado promotor. Somente uma das duas fitas serve de molde para síntese de RNA para um dado gene O RNA é sintetizado na direção 5’- 3’ RNA polimerase monta nucleotídeos livres em uma cadeia nova, utilizando o pareamento complementar A medida que a cadeia nova de RNA cresce, RNA polimerase se move ao longo do DNA A síntese de RNA continua até que a RNA polimerase atinja um local no DNA denominado terminador. A RNA polimerase e o mRNA recém-formado de fita simples são liberados do DNA
    • Transcrição Gene ativo RNA polimerase 5’ T G CA C 3’ A 3’ ATGGC A AU TACCG GC A T TA 3’ C G T 5’ 5’ C AU GG DNA - Fita moldeMolécula de RNA nascente complementar a fita molde•Fita única•No lugar da Timina haverá uma Uracila
    • Tradução Cada códon é traduzido num AA específico AA livre Ribossomo His Gly Phe GluProteína Asp Met Ala Cys tRNA 5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUAMolécula de mRNA codon Direção do avanço do ribossomo
    • Gly His Phe Glu Asp Met Ala Cys5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUA
    • Ile Met His Ala Gly Cys Asp Glu Phe5’ 3’ AUGGCAUGCGACGAAUUCGGACACAUA
    • Met Ala Cys Asp Glu Asn Phe Gly His Ile Lys Leu Met5’ 3’ GACGAAUUCGGACACAUAAAAUUAAUG
    • Ala Cys Asp Glu Phe Met Gly His Ile Lys Leu Met Asn Pro Gln5’ STOP 3’ AUAAAAUUAAUGAACCCACAAUAATAC
    • Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met5’ 3’ AUAAAAUUAAUGAACCCACAAUAATAC RNAm será degradado
    • Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn MetPROTEÍNA NORMAL
    • Exemplo hipotético de uma mutação pontual Gene Normal = Proteína Normal 5’ T G CA C 3’ ATGGC A A TACCG T T A C G T 3’ 5’ 3’ 5’ AUGGCAUGCGACGAAUUCGGACACAUA mRNA AlaninaGene Mutado =Proteína Anormal - G T 5’ T G CA C 3’ A ATGGA A TACCT TA T 3’ C G T 5’ 5’ 3’ AUGGAAUGCGACGAAUUCGGACACAUA mRNA Acido Glutâmico
    • A Tradução O RNAm transcrito no núcleo chega ao citoplasma e se liga a um ou mais ribossomos. O ribossomo “lê” o primeiro códon e um RNAt com o anticódon correspondente transporta um aminoácido e se liga ao códon. O ribossomo se desloca, no sentido 5’3’ e lê o próximo códon. Os aminoácidos são unidos por ligações peptídicas. Ao final da tradução o polipeptídeo se desliga e se constituí na proteína.
    • Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met e p Glu Ph G ly As sPROTEÍNA NORMAL Cy His Glu I le t Lys Me Leu G ln t ro P sn Me A PROTEÍNA DEFEITUOSA