Analise de mapas e desenho de iniciadores

1,054 views
878 views

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,054
On SlideShare
0
From Embeds
0
Number of Embeds
3
Actions
Shares
0
Downloads
18
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Analise de mapas e desenho de iniciadores

  1. 1. Prof. Dra. Adriana DantasDisciplina: BioinformáticaUERGS, Bento Gonçalves,RS
  2. 2. C T G G A C TCCTGATGGATCGCGTACGTTGTACGCACAGTGTCGAAAAAGCATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  3. 3. HomemCCTGATGGATCGCGTACGTTGTACGCACAGTGTCGAAAAAGCATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT BactériaGTGGATGGATCGCGGCAGTTGTACGCACAGTGTCGAACAAGCATACGGGGACTGCACCCCGATGTAGCACGGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAAATAGGA VírusCACACATTGTATCGACAGTTGTACGCACAGTGTCGAGGGCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTCGCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGAAGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT
  4. 4. Marcadores moleculares baseados em DNA/RNA  RFLP MARCADORES BASEADOS EM RESTRIÇÃO E  VNTR(Minissatélites) HIBRIDAÇÃO DE SEQUÊNCIAS DE DNA  RAPD  MICROSSATÉLITES - SSR  AFLP  cDNA+AFLP Reação de polimerase em  ESTs cadeia (PCR) RNA  SNPs  Marcadores organelas (cpDNA, rDNA)  Marcadores específicos (SCAR, CAPS, SSCP, STMS, RFLP-)
  5. 5. AFLPGene Vf(Sarna) Xu & Korban, 2000
  6. 6. LOCALIZAR MARCAS COM CARACTERÍSTICASAGRONÔMICAS DE INTERESSE
  7. 7. 840 marcadores:475 AFLPs235 RAPDs129 SSRs
  8. 8. Como validar as marcas? Desenvolvimento de um SCAR (S equence characterized amplified RAPD )4) identificação de um iniciador que confere polimorfismo a dois bulks de DNA com fenótipos contrastantes,5) o isolamento e a clonagem do fragmento amplificado em um vetor (plasmideo),6) sequenciamento do fragmento isolado,7) desenho dos iniciadores de tamanho maior que os decâmeros8) teste final (Paran e Michelmore, 1993).
  9. 9. SELEÇÃO ASSISTIDA POR MARCADORES (SAM) Marcador Primer Gene Referencia RAPDS OPM18900 CACCATCCGT Vf Koller et al.,1994 OPU01400 ACGGACGTA Vf Koller et al.,1994 OPD20500 ACCCGGTCAC Vf Yang & Kruger, 1994 OPC081100 TGGACCGGTG Vf Tartarini 1996 OPC09900 CTCACCGTCC Vf Tartarini 1996 OPAL07580 CCGTCCATCC Vf Tartarini 1996 OPAM192200 CCAGGTCTTC Vf Tartarini 1996 OPA15900 TTCCGAACCC Vf Durham and Korban 1994 OPO141700 AGCATGGCTC Vf King et al. 1998 OPAF132000 CCGAGGTGAC Vf King et al. 1998 OPAG051900 CCCACTAGAC Vf King et al. 1998 OPAG12800 CTCCCAGGGT Vf King et al. 1998 SSR CH05e03 For:CGAATATTTTCACTCTGACTGGG Vbj M.Gygax (Frey et al.,2004) Rev:CAAGTTGTTGTACTGCTCCGA CH02B10 For: CAAGGAAATCATCAAAGATTCAAG Vr Hemmat et al.,2002 Rev: CAAGTGGCTTCGGATAGT CHVf1 For: ATCACCACCAGCAGCAAAG Vf C.Gessler (Frey et al.,2004) Rev: CATACAAATCAAAGCACAACCC CH02c06 For: TGACGAAATCCACTACTAATGCA Vr Baldi et al.,2004 Rev: GATTGCGCGCTTTTTAACAT CH02C02a For: CTTCAAGTTCAGCATCAAGACAA Vr2 Patocchi et al., 2003 Rev: TAGGGCACACTTGCTGGTC CH02B07 For: CCAGACAAGTCATCACAACACTC Vd Calenge et al., 2005 Rev: ATGTCGATGTCGCTCTGTTG Primers específicos Vf Vfa1 For: TCTATCTCAGTAGTTTCTATAATTCC Vf Xu & Korban (2002) Rev:GTAGTTACTCTCAAGATTAAGAACTT Vfa2 For: CTCAATCTCAGTAGTTTCTATGGA Vf Xu & Korban (2002) Rev: CCCCCGAGATTAAGAGTTG Vfa3 For:ATATTAGTAGTTTCTATAATCTGAAGG Vf Xu & Korban (2002) Rev:CCCCCGAGATTAAGAGATG Vfa4 For:TATCTCAATCTCAGTAGTAATAGTATC Vf Xu & Korban (2002) Rev:GACCTTGGAAACCACAATC AL07/SCAR 450 464 For: TCCTTACTGAGGAGGAAACCAG Tartarini et al. (1999) Rev: CAAGGGAACTGATCTTTCGTTG ARGH ARGH 25/CH02B07 For:CAAACATCATCGTAATTTTGACG Vd Baldi et al.,2004 Rev:CATACTCTTCATGAGGATAATTC ARGH37 For:TGCACGACATTAGCAACACTG Vr2 Baldi et al.,2004 Rev:GAAACAACTTCTTTTGAGAGTTC ARGH17 For:TTGCCGACGTTCGTGATGCT Vr2 Baldi et al.,2004 Rev:GATATCCTTTGTTTGGACAACC ARGH 34/CHVf1 For:TGTATGACCAGCCGAAGGTG Vf1 Baldi et al.,2004 REv:CCAGGACAACAATGTACCTC
  10. 10.  O conhecimento de sintenia permite o acesso de reprodução, por exemplo, todos os alelos de todos os cereais, e não de única espécie. Transferência de genes para trigo do arroz. Gene foi encontrada em arroz por sintenia e, posteriormente, isolado e modificado pela alteração da seqüência de DNA que caracterizou genes do trigo antes de substituir o gene modificado de arroz.  Este método pode ser aplicado a qualquer gene de qualquer cereal, três principais de trigo, arroz e milho  Mais importante, no entanto, atualmente existe a possibilidade de combinar os conhecimentos de bioquímica, fisiologia e genética e transferência de uma cultura para outra por meio de sintenia.
  11. 11.  Reação em cadeia da polimerase (PCR)  Amplificar milhares de vezes um fragmento de DNA. Iniciadores é uma etapa chave para um PCR bem sucedido Necessita do conhecimento prévio da sequência de DNA alvo Uso de iniciador com parâmetros específicos, como:  Temperatura, tamanho, composição e conteúdo GC Parâmetros são calculados utilizando-se softwares específicos a fim de que os iniciadores se unam à sequência de DNA de interesse.
  12. 12.  O desenho dos iniciadores é dividido em várias fases: Busca e escolha das sequências de interesse; Alinhamento das sequências; Determinação do consenso; Seleção da região consenso mais conservada; Escolha e teste dos iniciadores.
  13. 13.  A Tm (Temperature melting)  mínimo 57°C, máximo 63°C e ótima de 60°C Percentual de GC contido na seqüência alvo de DNA  usualmente é de 40% a 60%  GC na constituição da fita justifica-se pelo fato de haver uma ligação mais forte entre esses nucleotídeos (através de três pontes de hidrogênio) comparada às duas pontes em AT.  Torna-se mais difícil de separar as fitas nas ligações GC que em AT. Tamanho dos fragmentos amplificados (amplicon)  varia de 100 a 300 nucleotídeos. Comprimento estipulado para os iniciadores  mínimo de 19, máximo de 22 e ideal de 20 pares de bases.
  14. 14.  Homepage Map Viewer: http://www.ncbi.nlm.nih.gov/mapview Selecione Homo sapiens Pesquisa (humano) a partir do menu pull-down, digite na caixa de FMR1 em seguida, selecione Go. Na página de resultados, quatro entradas são retornados (4 hits). FMR1 foi mapeado em três diferentes mapas: Genes_cyto, Genes_seq e Morbid Selecione o mapa Genes_seq para ver a estrutura do gene FMR1. Dois links à direita do mapa Genes_seq são de uso em recuperar os 5 e 3 DNA de acompanhamento,   No topo da página, Download / Ver Seqüência /
  15. 15.  Prec isamos ter uma sequencia de cDNA mas precisamos ter também a seqüência de nucleotídeos que se encontra 5 ou 3 de um gene ou os íntrons para análises adicionais. Pois a seqüência genômica disponível a partir do banco de dados público não pode ter essa anotação ou pode ser tão grande que torna difícil para recuperar apenas uma região de interesse, Ferramentas Map Viewer torna mais fácil de definir, visualizar e baixar seqüência genômica em vários formatos
  16. 16.  Usamos o visualizador de Mapa para procurar genes candidatos em uma região O Map Viewer oferece suporte a consultas por qualquer loco posicionado em um mapa Feito pelo número de acesso ou qualquer outro link que possa definir a sua faixa de interesse (loco no mapa).

×