Your SlideShare is downloading. ×
Dn atechn genomics-developmemt
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Saving this for later?

Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime - even offline.

Text the download link to your phone

Standard text messaging rates apply

Dn atechn genomics-developmemt

1,692
views

Published on


0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
1,692
On Slideshare
0
From Embeds
0
Number of Embeds
6
Actions
Shares
0
Downloads
95
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Chp. 12 • Overview: Understanding and Manipulating Genomes • One of the greatest achievements of modern science – Has been the sequencing of the human genome, which was largely completed by 2003 • DNA sequencing accomplishments – Have all depended on advances in DNA technology, starting with the invention of methods for making recombinant DNA
  • 2. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • DNA technology has launched a revolution in the area of biotechnology – The manipulation of organisms or their genetic components to make useful products • An example of DNA technology is the microarray – A measurement of gene expression of thousands of different genes
  • 3. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • DNA cloning permits production of multiple copies of a specific gene or other DNA segment • To work directly with specific genes – Scientists have developed methods for preparing well-defined, gene-sized pieces of DNA in multiple identical copies, a process called gene cloning
  • 4. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Overview of gene cloning with a bacterial plasmid, showing various uses of cloned genes Figure 20.2 Bacterium Bacterial chromosome Plasmid Cell containing gene of interest Recombinant DNA (plasmid) Gene of interest DNA of chromosome Recombinate bacterium Protein harvested Basic research on protein Gene of interest Copies of gene Basic research on gene Gene for pest resistance inserted into plants Gene used to alter bacteria for cleaning up toxic waste Protein dissolves blood clots in heart attack therapy Human growth hormone treats stunted growth Protein expressed by gene of interest 3 Gene inserted into plasmid 1 Plasmid put into bacterial cell 2 Host cell grown in culture, to form a clone of cells containing the “cloned” gene of interest 3 Basic research and various applications 4
  • 5. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Using Restriction Enzymes to Make Recombinant DNA • Bacterial restriction enzymes – Cut DNA molecules at a limited number of specific DNA sequences, called restriction sites
  • 6. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • A restriction enzyme will usually make many cuts in a DNA molecule – Yielding a set of restriction fragments • The most useful restriction enzymes cut DNA in a staggered way – Producing fragments with “sticky ends” that can bond with complementary “sticky ends” of other fragments • DNA ligase is an enzyme – That seals the bonds between restriction fragments
  • 7. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.3 Restriction site DNA 5 3 5 3  G A A T T C C T T A A G Sticky end Fragment from different DNA molecule cut by the same restriction enzyme One possible combination Recombinant DNA molecule G C T T A A A A T T C G A A T T C C T T A A G G G GA A T T C A A T T C C T T A A G C T T A A G • Using a restriction enzyme and DNA ligase to make recombinant DNA Restriction enzyme cuts the sugar-phosphate backbones at each arrow 1 DNA fragment from another source is added. Base pairing of sticky ends produces various combinations. 2 DNA ligase seals the strands. 3
  • 8. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Cloning a Eukraryotic Gene in a Bacterial Plasmid • In gene cloning, the original plasmid is called a cloning vector – Defined as a DNA molecule that can carry foreign DNA into a cell and replicate there
  • 9. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Producing Clones of Cells 1 Isolate plasmid DNA and human DNA. 2 Cut both DNA samples with the same restriction enzyme 3 Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. APPLICATION Cloning is used to prepare many copies of a gene of interest for use in sequencing the gene, in producing its encoded protein, in gene therapy, or in basic research. TECHNIQUE In this example, a human gene is inserted into a plasmid from E. coli. The plasmid contains the ampR gene, which makes E. coli cells resistant to the antibiotic ampicillin. It also contains the lacZ gene, which encodes -galactosidase. This enzyme hydrolyzes a molecular mimic of lactose (X-gal) to form a blue product. Only three plasmids and three human DNA fragments are shown, but millions of copies of the plasmid and a mixture of millions of different human DNA fragments would be present in the samples. Sticky ends Human DNA fragments Human cell Gene of interest Bacterial cell ampR gene (ampicillin resistance) Bacterial plasmid Restriction site Recombinant DNA plasmids lacZ gene (lactose breakdown) Figure 20.4
  • 10. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings RESULTS Only a cell that took up a plasmid, which has the ampR gene, will reproduce and form a colony. Colonies with nonrecombinant plasmids will be blue, because they can hydrolyze X-gal. Colonies with recombinant plasmids, in which lacZ is disrupted, will be white, because they cannot hydrolyze X-gal. By screening the white colonies with a nucleic acid probe (see Figure 20.5), researchers can identify clones of bacterial cells carrying the gene of interest. Colony carrying non- recombinant plasmid with intact lacZ gene Bacterial clone Colony carrying recombinant plasmid with disrupted lacZ gene Recombinant bacteria 4 Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene. 5 Plate the bacteria on agar containing ampicillin and X-gal. Incubate until colonies grow.
  • 11. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Identifying Clones Carrying a Gene of Interest • A clone carrying the gene of interest – Can be identified with a radioactively labeled nucleic acid probe that has a sequence complementary to the gene, a process called nucleic acid hybridization
  • 12. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings APPLICATION Hybridization with a complementary nucleic acid probe detects a specific DNA within a mixture of DNA molecules. In this example, a collection of bacterial clones (colonies) are screened to identify those carrying a plasmid with a gene of interest. TECHNIQUE Cells from each colony known to contain recombinant plasmids (white colonies in Figure 20.4, stap 5) are transferred to separate locations on a new agar plate and allowed to grow into visible colonies. This collection of bacterial colonies is the master plate. RESULTS Colonies of cells containing the gene of interest have been identified by nucleic acid hybridization. Cells from colonies tagged with the probe can be grown in large tanks of liquid growth medium. Large amounts of the DNA containing the gene of interest can be isolated from these cultures. By using probes with different nucleotide sequences, the collection of bacterial clones can be screened for different genes. Colonies containing gene of interest Filter Master plate Solution containing probe Filter lifted and flipped over Radioactive single-stranded DNA Hybridization on filter Single-stranded DNA from cell Probe DNA Gene of interest Film Master plate Figure 20.5 • Nucleic acid probe hybridization A special filter paper is pressed against the master plate, transferring cells to the bottom side of the filter. 1 The filter is treated to break open the cells and denature their DNA; the resulting single- stranded DNA molecules are treated so that they stick to the filter. 2 The filter is laid under photographic film, allowing any radioactive areas to expose the film (autoradiography). 3 After the developed film is flipped over, the reference marks on the film and master plate are aligned to locate colonies carrying the gene of interest. 4
  • 13. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Storing Cloned Genes in DNA Libraries • A genomic library made using bacteria – Is the collection of recombinant vector clones produced by cloning DNA fragments derived from an entire genome Figure 20.6 Foreign genome cut up with restriction enzyme Recombinant plasmids Recombinant phage DNA Phage clones (b) Phage library(a) Plasmid library or Bacterial clones
  • 14. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • A genomic library made using bacteriophages – Is stored as a collection of phage clones
  • 15. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • A complementary DNA (cDNA) library – Is made by cloning DNA made in vitro by reverse transcription of all the mRNA produced by a particular cell
  • 16. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Cloning and Expressing Eukaryotic Genes • As an alternative to screening a DNA library for a particular nucleotide sequence – The clones can sometimes be screened for a desired gene based on detection of its encoded protein
  • 17. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Bacterial Expression Systems • Several technical difficulties – Hinder the expression of cloned eukaryotic genes in bacterial host cells • To overcome differences in promoters and other DNA control sequences – Scientists usually employ an expression vector, a cloning vector that contains a highly active prokaryotic promoter
  • 18. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Eukaryotic Cloning and Expression Systems • The use of cultured eukaryotic cells as host cells and yeast artificial chromosomes (YACs) as vectors – Helps avoid gene expression problems
  • 19. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR) • The polymerase chain reaction, PCR – Can produce many copies of a specific target segment of DNA – Uses primers that bracket the desired sequence – Uses a heat-resistant DNA polymerase
  • 20. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • The PCR procedure Figure 20.7 Target sequence 53 5 Genomic DNA Cycle 1 yields 2 molecules Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence 5 3 3 5 Primers New nucleo- tides 3 APPLICATION With PCR, any specific segment—the target sequence—within a DNA sample can be copied many times (amplified) completely in vitro. TECHNIQUE The starting materials for PCR are double- stranded DNA containing the target nucleotide sequence to be copied, a heat-resistant DNA polymerase, all four nucleotides, and two short, single-stranded DNA molecules that serve as primers. One primer is complementary to one strand at one end of the target sequence; the second is complementary to the other strand at the other end of the sequence. RESULTS During each PCR cycle, the target DNA sequence is doubled. By the end of the third cycle, one-fourth of the molecules correspond exactly to the target sequence, with both strands of the correct length (see white boxes above). After 20 or so cycles, the target sequence molecules outnumber all others by a billionfold or more. Denaturation: Heat briefly to separate DNA strands 1 Annealing: Cool to allow primers to hydrogen-bond. 2 Extension: DNA polymerase adds nucleotides to the 3 end of each primer 3
  • 21. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Restriction fragment analysis detects DNA differences that affect restriction sites • Restriction fragment analysis – Can rapidly provide useful comparative information about DNA sequences
  • 22. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Gel Electrophoresis and Southern Blotting • Gel electrophoresis – Separates DNA restriction fragments of different lengths (smaller fragments travel the farthest) Figure 20.8 APPLICATION 1 Each sample, a mixture of DNA molecules, is placed in a separate well near one end of a thin slab of gel. The gel is supported by glass plates, bathed in an aqueous solution, and has electrodes attached to each end. 2 When the current is turned on, the negatively charged DNA molecules move toward the positive electrode, with shorter molecules moving faster than longer ones. Bands are shown here in blue, but on an actual gel, DNA bands are not visible until a DNA-binding dye is added. The shortest molecules, having traveled farthest, end up in bands at the bottom of the gel. Cathode Power source Gel Glass plates Anode Mixture of DNA molecules of differ- ent sizes Longer molecules Shorter molecules TECHNIQUE RESULTS After the current is turned off, a DNA-binding dye is added. This dye fluoresces pink in ultraviolet light, revealing the separated bands to which it binds. In this actual gel, the pink bands correspond to DNA fragments of different lengths separated by electrophoresis. If all the samples were initially cut with the same restriction enzyme, then the different band patterns indicate that they came from different sources. Gel electrophoresis is used for separating nucleic acids or proteins that differ in size, electrical charge, or other physical properties. DNA molecules are separated by gel electrophoresis in restriction fragment analysis of both cloned genes (see Figure 20.9) and genomic DNA (see Figure 20.10). Gel electrophoresis separates macromolecules on the basis of their rate of movement through a gel in an electric field. How far a DNA molecule travels while the current is on is inversely proportional to its length. A mixture of DNA molecules, usually fragments produced by restriction enzyme digestion, is separated into “bands”; each band contains thousands of molecules of the same length.
  • 23. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Restriction fragment analysis – Is useful for comparing two different DNA molecules, such as two alleles for a gene Figure 20.9a, b Normal  -globin allele Sickle-cell mutant -globin allele 175 bp 201 bp Large fragment DdeI DdeI DdeI DdeI DdeI DdeI DdeI 376 bp Large fragment DdeI restriction sites in normal and sickle-cell alleles of -globin gene. Electrophoresis of restriction fragments from normal and sickle-cell alleles. Normal allele Sickle-cell allele Large fragment 201 bp 175 bp 376 bp (a) (b)
  • 24. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Specific DNA fragments can be identified by Southern blotting – Using labeled probes (radioactive or fluorescent substance) that hybridize to the DNA immobilized on a “blot” of the gel
  • 25. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Southern blotting of DNA fragments APPLICATION Researchers can detect specific nucleotide sequences within a DNA sample with this method. In particular, Southern blotting is useful for comparing the restriction fragments produced from different samples of genomic DNA. TECHNIQUE In this example, we compare genomic DNA samples from three individuals: a homozygote for the normal -globin allele (I), a homozygote for the mutant sickle-cell allele (II), and a heterozygote (III). DNA + restriction enzyme Restriction fragments I II III I Normal -globin allele II Sickle-cell allele III Heterozygote Preparation of restriction fragments. Gel electrophoresis. Blotting. Gel Sponge Alkaline solution Nitrocellulose paper (blot) Heavy weight Paper towels 1 2 3 Figure 20.10
  • 26. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings RESULTS Because the band patterns for the three samples are clearly different, this method can be used to identify heterozygous carriers of the sickle-cell allele (III), as well as those with the disease, who have two mutant alleles (II), and unaffected individuals, who have two normal alleles (I). The band patterns for samples I and II resemble those observed for the purified normal and mutant alleles, respectively, seen in Figure 20.9b. The band pattern for the sample from the heterozygote (III) is a combination of the patterns for the two homozygotes (I and II). Radioactively labeled probe for -globin gene is added to solution in a plastic bag Probe hydrogen- bonds to fragments containing normal or mutant -globin Fragment from sickle-cell -globin allele Fragment from normal -globin allele Paper blot Film over paper blot Hybridization with radioactive probe. Autoradiography. I II III I II III 1 2
  • 27. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Restriction Fragment Length Differences as Genetic Markers • Restriction fragment length polymorphisms (RFLPs) – Are differences in DNA sequences on homologous chromosomes that result in restriction fragments of different lengths
  • 28. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Specific fragments – Can be detected and analyzed by Southern blotting • The thousands of RFLPs present throughout eukaryotic DNA – Can serve as genetic markers
  • 29. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Entire genomes can be mapped at the DNA level • The Human Genome Project – Sequenced the human genome • Scientists have also sequenced genomes of other organisms – Providing important insights of general biological significance
  • 30. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Linkage mapping, physical mapping, and DNA sequencing – Represent the overarching strategy of the Human Genome Project • An alternative approach to sequencing whole genomes starts with the sequencing of random DNA fragments – Powerful computer programs would then assemble the resulting very large number of overlapping short sequences into a single continuous sequence
  • 31. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings 1 2 3 4 Cut the DNA from many copies of an entire chromosome into overlapping frag- ments short enough for sequencing. Clone the fragments in plasmid or phage vectors Sequence each fragment Order the sequences into one overall sequence with computer software. ACGATACTGGT CGCCATCAGT ACGATACTGGT AGTCCGCTATACGA …ATCGCCATCAGTCCGCTATACGATACTGGTCAA…Figure 20.13
  • 32. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Genome sequences provide clues to important biological questions • In genomics – Scientists study whole sets of genes and their interactions
  • 33. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Current estimates are that the human genome contains about 25,000 genes – But the number of human proteins is much larger Table 20.1
  • 34. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Studying Expression of Interacting Groups of Genes • DNA microarray assays allow researchers to compare patterns of gene expression – In different tissues, at different times, or under different conditions
  • 35. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • DNA microarray assay of gene expression levels APPLICATION TECHNIQUE Tissue sample mRNA molecules Labeled cDNA molecules (single strands) DNA microarray Size of an actual DNA microarray with all the genes of yeast (6,400 spots) Isolate mRNA.1 With this method, researchers can test thousands of genes simultaneously to determine which ones are expressed in a particular tissue, under different environmental conditions in various disease states, or at different developmental stages. They can also look for coordinated gene expression. Make cDNA by reverse transcription, using fluores-cently labeled nucleotides.2 Apply the cDNA mixture to a microarray, a microscope slide on which copies of single- stranded DNA fragments from the organism‘s genes are fixed, a different gene in each spot. The cDNA hybridizes with any complementary DNA on the microarray. 3 Rinse off excess cDNA; scan microarray for fluorescence. Each fluorescent spot (yellow) represents a gene expressed in the tissue sample. 4 RESULT The intensity of fluorescence at each spot is a measure of the expression of the gene represented by that spot in the tissue sample. Commonly, two different samples are tested together by labeling the cDNAs prepared from each sample with a differently colored fluorescence label. The resulting color at a spot reveals the relative levels of expression of a particular gene in the two samples, which may be from different tissues or the same tissue under different conditions. Figure 20.14
  • 36. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Future Directions in Genomics • Genomics – Is the study of entire genomes (Comparative studies of genomes from related and widely divergent species) • Proteomics – Is the systematic study of all the proteins encoded by a genome
  • 37. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • The practical applications of DNA technology affect our lives in many ways • Numerous fields are benefiting from DNA technology and genetic engineering • Medical scientists can now diagnose hundreds of human genetic disorders – By using PCR and primers corresponding to cloned disease genes, then sequencing the amplified product to look for the disease- causing mutation
  • 38. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Even when a disease gene has not yet been cloned – The presence of an abnormal allele can be diagnosed with reasonable accuracy if a closely linked RFLP marker has been found Figure 20.15 RFLP marker DNA Restriction sites Disease-causing allele Normal allele
  • 39. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Human Gene Therapy • Gene therapy – Is the alteration of an afflicted individual’s genes – Holds great potential for treating disorders traceable to a single defective gene – Uses various vectors for delivery of genes into cells
  • 40. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.16 Bone marrow cell from patient Retrovirus capsid Viral RNA Cloned gene (normal allele, absent from patient’s cells) 2 • Gene therapy using a retroviral vector Insert RNA version of normal allele into retrovirus. 1 Let retrovirus infect bone marrow cells that have been removed from the patient and cultured. 2 Viral DNA carrying the normal allele inserts into chromosome. 3 Inject engineered cells into patient. 4
  • 41. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Forensic Evidence • DNA “fingerprints” obtained by analysis of tissue or body fluids found at crime scenes – Can provide definitive evidence that a suspect is guilty or not • DNA fingerprinting – Can also be used in establishing paternity Defendant’s blood (D) Blood from defendant’s clothes Victim’s blood (V) D Jeans shirt V 4 g 8 g
  • 42. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Environmental Cleanup • Genetic engineering can be used to modify the metabolism of microorganisms – So that they can be used to extract minerals from the environment or degrade various types of potentially toxic waste materials • DNA technology – Is being used to improve agricultural productivity and food quality
  • 43. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Animal Husbandry and “Pharm” Animals • Transgenic animals – Contain genes from other organisms – Have been engineered to be pharmaceutical “factories Figure 20.18 Agricultural scientists Have already endowed a number of crop plants with genes for desirable traits
  • 44. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • The Ti plasmid – Is the most commonly used vector for introducing new genes into plant cells APPLICATION Genes conferring useful traits, such as pest resistance, herbicide resistance, delayed ripening, and increased nutritional value, can be transferred from one plant variety or species to another using the Ti plasmid as a vector. TECHNIQUE Transformed cells carrying the transgene of interest can regenerate complete plants that exhibit the new trait conferred by the transgene. RESULTS 1 The Ti plasmid is isolated from the bacterium Agrobacterium tumefaciens. The segment of the plasmid that integrates into the genome of host cells is called T DNA. 2 Isolated plasmids and foreign DNA containing a gene of interest are incubated with a restriction enzyme that cuts in the middle of T DNA. After base pairing occurs between the sticky ends of the plasmids and foreign DNA fragments, DNA ligase is added. Some of the resulting stable recombinant plasmids contain the gene of interest. 3 Recombinant plasmids can be introduced into cultured plant cells by electroporation. Or plasmids can be returned to Agrobacterium, which is then applied as a liquid suspension to the leaves of susceptible plants, infecting them. Once a plasmid is taken into a plant cell, its T DNA integrates into the cell‘s chromosomal DNA. Agrobacterium tumefaciens Ti plasmid Site where restriction enzyme cuts T DNA DNA with the gene of interest Recombinant Ti plasmid Plant with new trait Figure 20.19
  • 45. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Safety and Ethical Questions Raised by DNA Technology • The potential benefits of genetic engineering – Must be carefully weighed against the potential hazards of creating products or developing procedures that are harmful to humans or the environment • Today, most public concern about possible hazards – Centers on genetically modified (GM) organisms used as food
  • 46. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • From Single Cell to Multicellular Organism • The application of genetic analysis and DNA technology – Has revolutionized the study of development
  • 47. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Embryonic development involves cell division, cell differentiation, and morphogenesis • In the embryonic development of most organisms – A single-celled zygote gives rise to cells of many different types, each with a different structure and corresponding function Figure 21.3a, b (a) Fertilized eggs of a frog (b) Tadpole hatching from egg
  • 48. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Through a succession of mitotic cell divisions – The zygote gives rise to a large number of cells • In cell differentiation – Cells become specialized in structure and function • Morphogenesis encompasses the processes – That give shape to the organism and its various parts
  • 49. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • The three processes of development overlap in time Figure 21.4a, b Animal development. Most animals go through some variation of the blastula and gastrula stages. The blastula is a sphere of cells surrounding a fluid-filled cavity. The gastrula forms when a region of the blastula folds inward, creating a tube—a rudimentary gut. Once the animal is mature, differentiation occurs in only a limited way—for the replacement of damaged or lost cells. Plant development. In plants with seeds, a complete embryo develops within the seed. Morphogenesis, which involves cell division and cell wall expansion rather than cell or tissue movement, occurs throughout the plant’s lifetime. Apical meristems (purple) continuously arise and develop into the various plant organs as the plant grows to an indeterminate size. Zygote (fertilized egg) Eight cells Blastula (cross section) Gastrula (cross section) Adult animal (sea star) Cell movement Gut Cell division Morphogenesis Observable cell differentiation Seed leaves Shoot apical meristem Root apical meristem Plant Embryo inside seed Two cells Zygote (fertilized egg) (a) (b)
  • 50. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Different cell types result from differential gene expression in cells with the same DNA • Differences between cells in a multicellular organism – Come almost entirely from differences in gene expression, not from differences in the cells’ genomes
  • 51. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Evidence for Genomic Equivalence • Many experiments support the conclusion that – Nearly all the cells of an organism have genomic equivalence, that is, they have the same genes
  • 52. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • A totipotent cell (stem cell) – Is one capable of generating a complete new organism • Cloning – Is using one or more somatic cells from a multicellular organism to make another genetically identical individual • In nuclear transplantation – The nucleus of an unfertilized egg cell or zygote is replaced with the nucleus of a differentiated cell
  • 53. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Reproductive Cloning of Mammals • In 1997, Scottish researchers – Cloned a lamb from an adult sheep by nuclear transplantation
  • 54. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Nucleus removed Mammary cell donor Egg cell donor Egg cell from ovary Cultured mammary cells are semistarved, arresting the cell cycle and causing dedifferentiation Nucleus from mammary cell Grown in culture Early embryo Implanted in uterus of a third sheep Surrogate mother Embryonic development Lamb (“Dolly”) genetically identical to mammary cell donor 4 5 6 1 2 3 Cells fused APPLICATION This method is used to produce cloned animals whose nuclear genes are identical to the donor animal supplying the nucleus. TECHNIQUE Shown here is the procedure used to produce Dolly, the first reported case of a mammal cloned using the nucleus of a differentiated cell. RESULTS The cloned animal is identical in appearance and genetic makeup to the donor animal supplying the nucleus, but differs from the egg cell donor and surrogate mother. Nucleus removed Figure 21.7
  • 55. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • “Copy Cat” – Was the first cat ever cloned Figure 21.8
  • 56. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Problems Associated with Animal Cloning • In most nuclear transplantation studies performed thus far – Only a small percentage of cloned embryos develop normally to birth
  • 57. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings The Stem Cells of Animals • A stem cell (either totipotent or pluripotent) – Is a relatively unspecialized cell – Can reproduce itself indefinitely – Can differentiate into specialized cells of one or more types, given appropriate conditions
  • 58. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 21.9 Early human embryo at blastocyst stage (mammalian equiva- lent of blastula) From bone marrow in this example Totipotent cells Pluripotent cells Cultured stem cells Different culture conditions Different types of differentiated cells Liver cells Nerve cells Blood cells Embryonic stem cells Adult stem cells • Stem cells can be isolated – From early embryos at the blastocyst stage
  • 59. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Adult stem cells – Are said to be pluripotent, able to give rise to multiple but not all cell types
  • 60. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Transcriptional Regulation of Gene Expression During Development • Cell determination – Precedes differentiation and involves the expression of genes for tissue-specific proteins • Tissue-specific proteins – Enable differentiated cells to carry out their specific tasks
  • 61. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings DNA OFF OFF OFF mRNA mRNA mRNA mRNA mRNA Another transcription factor MyoD Muscle cell (fully differentiated) MyoD protein (transcription factor) Myoblast (determined) Embryonic precursor cell Myosin, other muscle proteins, and cell-cycle blocking proteins Other muscle-specific genesMaster control gene myoD Nucleus Determination. Signals from other cells lead to activation of a master regulatory gene called myoD, and the cell makes MyoD protein, a transcription factor. The cell, now called a myoblast, is irreversibly committed to becoming a skeletal muscle cell. 1 Differentiation. MyoD protein stimulates the myoD gene further, and activates genes encoding other muscle-specific transcription factors, which in turn activate genes for muscle proteins. MyoD also turns on genes that block the cell cycle, thus stopping cell division. The nondividing myoblasts fuse to become mature multinucleate muscle cells, also called muscle fibers. 2 • Determination and differentiation of muscle cells Figure 21.10
  • 62. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Cytoplasmic Determinants and Cell-Cell Signals in Cell Differentiation • Cytoplasmic determinants in the cytoplasm of the unfertilized egg – Regulate the expression of genes in the zygote that affect the developmental fate of embryonic cells Sperm Molecules of another cyto- plasmic deter- minant Figure 21.11a Unfertilized egg cell Molecules of a a cytoplasmic determinant Fertilization Zygote (fertilized egg) Mitotic cell division Two-celled embryo Cytoplasmic determinants in the egg. The unfertilized egg cell has molecules in its cytoplasm, encoded by the mother’s genes, that influence development. Many of these cytoplasmic determinants, like the two shown here, are unevenly distributed in the egg. After fertilization and mitotic division, the cell nuclei of the embryo are exposed to different sets of cytoplasmic determinants and, as a result, express different genes. (a) Nucleus Sperm
  • 63. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Pattern formation in animals and plants results from similar genetic and cellular mechanisms • Pattern formation – Is the development of a spatial organization of tissues and organs – Occurs continually in plants – Is mostly limited to embryos and juveniles in animals
  • 64. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Positional information – Consists of molecular cues that control pattern formation – Tells a cell its location relative to the body’s axes and to other cells Figure 21.12 Follicle cell Nucleus Egg cell Fertilization Nurse cell Egg cell developing within ovarian follicle Laying of egg Egg shellNucleus Fertilized egg Embryo Multinucleate single cell Early blastoderm Plasma membrane formation Late blastoderm Cells of embryo Yolk Segmented embryo Body segments 0.1 mm Hatching Larval stages (3) Pupa Metamorphosis Head Thorax Abdomen 0.5 mm Adult fly Dorsal Anterior Posterior Ventral BODY AXES Eye Antenna Leg Wild type Mutant
  • 65. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Programmed Cell Death (Apoptosis) • In apoptosis – Cell signaling is involved in programmed cell death 2 µm Figure 21.17
  • 66. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • In vertebrates – Apoptosis is essential for normal morphogenesis of hands and feet in humans and paws in other animals Figure 21.19 Interdigital tissue 1 mm
  • 67. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Comparison of Animal and Plant Development • In both plants and animals – Development relies on a cascade of transcriptional regulators turning genes on or off in a finely tuned series