• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Sintesis de proteinas
 

Sintesis de proteinas

on

  • 306 views

 

Statistics

Views

Total Views
306
Views on SlideShare
282
Embed Views
24

Actions

Likes
0
Downloads
3
Comments
0

1 Embed 24

http://biologiajaramillomariajose.blogspot.com 24

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Sintesis de proteinas Sintesis de proteinas Presentation Transcript

    • Síntesis de proteínas
    • Repaso de proteínas Las proteínas están formados por la unión de miles de otras moléculas más pequeñas llamadas aminoácidos. Sólo existen 20 tipos diferentes de aminoácidos que se combinan entre sí para formar miles de proteínas diferentes. Unas proteínas se diferencian de otras en el orden en que aparecen los aminoácidos.
    • La síntesis de proteínas ocurre en 2 etapas: A partir del ADN se crea  una molécula de ARN  -Transcripción del ADN mensajero (ARNm).  (ocurre en el núcleo de la célula)    Etapas    A partir del ARNm  -Traducción del ARN mensajero se crea una proteína. (ocurre en el citoplasma de la célula)  
    • 1-Transcripción del ADN El ADN, situado en el núcleo, no puede salir al citoplasma a través de los poros del núcleo, para formar las proteínas, y necesita una copia exacta de él, pero que sí pueda salir. Para ello se fabrica una molécula de ARN mensajero (ARNm) de la siguiente forma. Una molécula llamada polimerasa separa las 2 cadenas de ADN. Los nucleótidos sueltos por el núcleo, se van enlazando en una de las cadenas de ADN libres. Pero los nucleótidos sólo se unirán con aquel que sea su complementario, es decir:
    • ADN Adenina Citosina Guanina Timina ARNm Uracilo Guanina Citosina Adenina A continuación se separa el ARNm y se dirige hacia el citoplasma en busca de los ribosomas.
    • Transcripción del ADN por la polimerasa
    • La transcripción: Síntesis de ARN. 5’ 3’ polimerasa 5’ 3’ A T (i) U G U A C A G C G G C U G C C G C C G A C G ARN ADN
    • Ejercicio Transcribe la siguiente secuencia de ADN en ARNm. Figura 1 Figura 2
    • 2-Traducción del ARN mensajero El ARNm se dirige hacia los ribosomas, que es donde se fabrican las proteínas. Los ribosomas “leen” la secuencia de nucleótidos del ARNm y van colocando los aminoácidos libres del citoplasma en su lugar correspondiente. ¿ Cómo se traduce la cadena de nucleótidos en cadena de aminoácidos ?
    • La relación entre la secuencia de nucleótidos del ARNm y la secuencia de aminoácidos de una proteína se llama código genético. Unos de lo grandes logros de la Biología fue descubrirlo, y entre ellos estuvo el español Severo Ochoa (premio nobel). (1905-1993)
    • Tercera Letra La cadena de ARNm se lee de 3 en 3 nucleótidos (codón) y cada codón se relaciona con un aminoácido de la siguiente forma.
    • Ejercicio Deduce la secuencia de las bases nitrogenadas del ARNm y del ADN necesarias para obtener la proteína formada por los siguientes aminoácidos. Amino Inicio ácido ARNm (codón) ADN Leucina Alanina Prolina Serina AUG UUA GCU CCU TAC ADN AAT UCU Arginina Arginina CGU CGU GUU UAA CGA GCA AGA GCA Valina GCA CAA Fin ATT TACAATCGAGCAAGAGCAGCACAAATT
    • Ejercicio Indica la secuencia de aminoácidos que tendremos a partir de la siguiente fragmento de ADN. AUGCCUAGUGGCUCUGUGAAACAUUCAUAUUAA Solución: Prolina Serina Glicina Serina Valina Lisina Histidina Serina Tirosina
    • Por tanto el ribosoma se fija a un ARNm, y comienzan a leer la secuencia de nucleótidos. Al reconocer los 3 primeros nucleótidos el ARN transferente (ARNt) llevará el aminoácido correspondiente hasta el ARNm. Para cada codón del ARNm le corresponde un anticodón (3 bases nitrogenadas) del ARNt siendo la única posibilidad de enlace: Codón (ARNm) Adenina Citosina Guanina Timina Anticodón (ARNt) Uracilo Guanina Citosina Adenina
    • Codón Codón Anticodón Anticodón
    • El ribosoma avanza por la molécula de ARNm, lee el siguiente codón, y otra molécula de ARNt traerá el aminoácido que corresponda, que se unirá al primero para ir formando la proteína. Siempre hay un codón de inicio de la síntesis de proteínas y otro de terminación. Al llegar al codón de terminación, el ARNm queda libre y puede ser leído de nuevo por otro ribosoma. La proteína formada dará lugar al caracteres de un individuo.
    • Actividad final Completa la siguiente tabla ADN ADN complementario AGA ARNm CUG Anticodón Aminoácido AUU Metionina